FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625941_at:

>probe:Drosophila_2:1625941_at:260:467; Interrogation_Position=456; Antisense; GTATGACGAGGAAACCGGCGAGCAC
>probe:Drosophila_2:1625941_at:555:175; Interrogation_Position=467; Antisense; AAACCGGCGAGCACGGCGATCATGG
>probe:Drosophila_2:1625941_at:586:409; Interrogation_Position=502; Antisense; GACGAGGCGTCCTTTGCCAGCTCTA
>probe:Drosophila_2:1625941_at:8:55; Interrogation_Position=593; Antisense; ATGACTTCCTCAACTCGCTGAAGCG
>probe:Drosophila_2:1625941_at:568:613; Interrogation_Position=611; Antisense; TGAAGCGCCGTCAGGCGAACGCGAA
>probe:Drosophila_2:1625941_at:320:381; Interrogation_Position=627; Antisense; GAACGCGAAGAAGCACCGTGCCGAG
>probe:Drosophila_2:1625941_at:285:205; Interrogation_Position=670; Antisense; AAGCCGGCCAAGAAGAGCGACGAGT
>probe:Drosophila_2:1625941_at:53:409; Interrogation_Position=688; Antisense; GACGAGTCCAACTCCGGCGAGCAGG
>probe:Drosophila_2:1625941_at:354:437; Interrogation_Position=712; Antisense; GAGGAGCAGGCATCCGCGCCAGCAC
>probe:Drosophila_2:1625941_at:68:47; Interrogation_Position=747; Antisense; ATCCAGTCCCGCCAAGGGCTACAAG
>probe:Drosophila_2:1625941_at:219:223; Interrogation_Position=769; Antisense; AAGGGCAACTCAGCATTGAGCCGTC
>probe:Drosophila_2:1625941_at:159:3; Interrogation_Position=783; Antisense; ATTGAGCCGTCGCAAGCTGTCGAAG
>probe:Drosophila_2:1625941_at:244:51; Interrogation_Position=842; Antisense; ATGCCGCCGCTGAGGAATCGGAGCA
>probe:Drosophila_2:1625941_at:346:501; Interrogation_Position=905; Antisense; GTCGTCTGGCCCTGCGGAAGCGCAA

Paste this into a BLAST search page for me
GTATGACGAGGAAACCGGCGAGCACAAACCGGCGAGCACGGCGATCATGGGACGAGGCGTCCTTTGCCAGCTCTAATGACTTCCTCAACTCGCTGAAGCGTGAAGCGCCGTCAGGCGAACGCGAAGAACGCGAAGAAGCACCGTGCCGAGAAGCCGGCCAAGAAGAGCGACGAGTGACGAGTCCAACTCCGGCGAGCAGGGAGGAGCAGGCATCCGCGCCAGCACATCCAGTCCCGCCAAGGGCTACAAGAAGGGCAACTCAGCATTGAGCCGTCATTGAGCCGTCGCAAGCTGTCGAAGATGCCGCCGCTGAGGAATCGGAGCAGTCGTCTGGCCCTGCGGAAGCGCAA

Full Affymetrix probeset data:

Annotations for 1625941_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720