Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625943_at:

>probe:Drosophila_2:1625943_at:572:351; Interrogation_Position=15; Antisense; GCACAACAAAAATCGATAGGCCCAT
>probe:Drosophila_2:1625943_at:209:457; Interrogation_Position=29; Antisense; GATAGGCCCATCGATAATTCTGCGC
>probe:Drosophila_2:1625943_at:10:71; Interrogation_Position=32; Antisense; AGGCCCATCGATAATTCTGCGCCAT
>probe:Drosophila_2:1625943_at:628:307; Interrogation_Position=36; Antisense; CCATCGATAATTCTGCGCCATCTTT
>probe:Drosophila_2:1625943_at:188:43; Interrogation_Position=38; Antisense; ATCGATAATTCTGCGCCATCTTTCT
>probe:Drosophila_2:1625943_at:544:31; Interrogation_Position=42; Antisense; ATAATTCTGCGCCATCTTTCTTTTT
>probe:Drosophila_2:1625943_at:367:245; Interrogation_Position=44; Antisense; AATTCTGCGCCATCTTTCTTTTTCG
>probe:Drosophila_2:1625943_at:640:623; Interrogation_Position=49; Antisense; TGCGCCATCTTTCTTTTTCGGGATC
>probe:Drosophila_2:1625943_at:186:271; Interrogation_Position=54; Antisense; CATCTTTCTTTTTCGGGATCCGCAC
>probe:Drosophila_2:1625943_at:428:709; Interrogation_Position=59; Antisense; TTCTTTTTCGGGATCCGCACACCAA
>probe:Drosophila_2:1625943_at:155:601; Interrogation_Position=64; Antisense; TTTCGGGATCCGCACACCAAGTTAA
>probe:Drosophila_2:1625943_at:536:639; Interrogation_Position=66; Antisense; TCGGGATCCGCACACCAAGTTAAGA
>probe:Drosophila_2:1625943_at:392:529; Interrogation_Position=68; Antisense; GGGATCCGCACACCAAGTTAAGAGA
>probe:Drosophila_2:1625943_at:537:449; Interrogation_Position=70; Antisense; GATCCGCACACCAAGTTAAGAGAGC

Paste this into a BLAST search page for me
GCACAACAAAAATCGATAGGCCCATGATAGGCCCATCGATAATTCTGCGCAGGCCCATCGATAATTCTGCGCCATCCATCGATAATTCTGCGCCATCTTTATCGATAATTCTGCGCCATCTTTCTATAATTCTGCGCCATCTTTCTTTTTAATTCTGCGCCATCTTTCTTTTTCGTGCGCCATCTTTCTTTTTCGGGATCCATCTTTCTTTTTCGGGATCCGCACTTCTTTTTCGGGATCCGCACACCAATTTCGGGATCCGCACACCAAGTTAATCGGGATCCGCACACCAAGTTAAGAGGGATCCGCACACCAAGTTAAGAGAGATCCGCACACCAAGTTAAGAGAGC

Full Affymetrix probeset data:

Annotations for 1625943_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime