FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625946_at:

>probe:Drosophila_2:1625946_at:307:729; Interrogation_Position=1090; Antisense; TTGGTGCTCACGGTAATAATATATG
>probe:Drosophila_2:1625946_at:276:55; Interrogation_Position=1112; Antisense; ATGACATTTCGATTAGTTGTGGAAC
>probe:Drosophila_2:1625946_at:435:465; Interrogation_Position=1127; Antisense; GTTGTGGAACTAACTACTACCTGAC
>probe:Drosophila_2:1625946_at:581:583; Interrogation_Position=1131; Antisense; TGGAACTAACTACTACCTGACCACT
>probe:Drosophila_2:1625946_at:408:193; Interrogation_Position=1138; Antisense; AACTACTACCTGACCACTCTTGTGT
>probe:Drosophila_2:1625946_at:118:673; Interrogation_Position=1144; Antisense; TACCTGACCACTCTTGTGTTCAGTT
>probe:Drosophila_2:1625946_at:183:415; Interrogation_Position=1149; Antisense; GACCACTCTTGTGTTCAGTTTGATA
>probe:Drosophila_2:1625946_at:88:259; Interrogation_Position=1152; Antisense; CACTCTTGTGTTCAGTTTGATAAAT
>probe:Drosophila_2:1625946_at:709:699; Interrogation_Position=1207; Antisense; TTTTGACATTTTGAATTCGACTATA
>probe:Drosophila_2:1625946_at:242:541; Interrogation_Position=1294; Antisense; GGTTTTTTGATTTCTCCACAGGTCA
>probe:Drosophila_2:1625946_at:189:701; Interrogation_Position=1298; Antisense; TTTTGATTTCTCCACAGGTCATAAG
>probe:Drosophila_2:1625946_at:444:17; Interrogation_Position=1303; Antisense; ATTTCTCCACAGGTCATAAGTGCGT
>probe:Drosophila_2:1625946_at:602:153; Interrogation_Position=1311; Antisense; ACAGGTCATAAGTGCGTACATATTT
>probe:Drosophila_2:1625946_at:68:221; Interrogation_Position=1320; Antisense; AAGTGCGTACATATTTTGTTGGCTT

Paste this into a BLAST search page for me
TTGGTGCTCACGGTAATAATATATGATGACATTTCGATTAGTTGTGGAACGTTGTGGAACTAACTACTACCTGACTGGAACTAACTACTACCTGACCACTAACTACTACCTGACCACTCTTGTGTTACCTGACCACTCTTGTGTTCAGTTGACCACTCTTGTGTTCAGTTTGATACACTCTTGTGTTCAGTTTGATAAATTTTTGACATTTTGAATTCGACTATAGGTTTTTTGATTTCTCCACAGGTCATTTTGATTTCTCCACAGGTCATAAGATTTCTCCACAGGTCATAAGTGCGTACAGGTCATAAGTGCGTACATATTTAAGTGCGTACATATTTTGTTGGCTT

Full Affymetrix probeset data:

Annotations for 1625946_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720