FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625947_at:

>probe:Drosophila_2:1625947_at:508:257; Interrogation_Position=261; Antisense; CACCTTTCAGTTTGAGCCGTACAAC
>probe:Drosophila_2:1625947_at:125:311; Interrogation_Position=308; Antisense; CCAATTTCAAGCTGGCTGTGGCCAT
>probe:Drosophila_2:1625947_at:534:385; Interrogation_Position=369; Antisense; GAACATTGGCTATGCAACACCAGAA
>probe:Drosophila_2:1625947_at:449:123; Interrogation_Position=397; Antisense; AGCCGATCCTCCATCATGGATTTTA
>probe:Drosophila_2:1625947_at:287:17; Interrogation_Position=435; Antisense; ATTTCCGGACGTGATTGCCCGACTA
>probe:Drosophila_2:1625947_at:528:541; Interrogation_Position=466; Antisense; GGTTCCGGAAAGTACCAGGTGCTAT
>probe:Drosophila_2:1625947_at:348:105; Interrogation_Position=495; Antisense; AGACTACGAGAACTTCGCCATCTTG
>probe:Drosophila_2:1625947_at:520:567; Interrogation_Position=529; Antisense; GGCAGCATTGGCTCACTGGGTCACT
>probe:Drosophila_2:1625947_at:510:531; Interrogation_Position=546; Antisense; GGGTCACTCCGATCAGATCTGGATT
>probe:Drosophila_2:1625947_at:692:461; Interrogation_Position=567; Antisense; GATTCTTGGACGTGATCGGGACTTC
>probe:Drosophila_2:1625947_at:545:683; Interrogation_Position=600; Antisense; TATCCGATCCAAAGTGTACGACGTG
>probe:Drosophila_2:1625947_at:134:487; Interrogation_Position=615; Antisense; GTACGACGTGTTGAAGCGGCTCTCT
>probe:Drosophila_2:1625947_at:425:449; Interrogation_Position=643; Antisense; GATCCGGAAAGGCTCATCATCAGCA
>probe:Drosophila_2:1625947_at:449:185; Interrogation_Position=674; Antisense; AACAATGCCCCGAGGCGCTGTAGGA

Paste this into a BLAST search page for me
CACCTTTCAGTTTGAGCCGTACAACCCAATTTCAAGCTGGCTGTGGCCATGAACATTGGCTATGCAACACCAGAAAGCCGATCCTCCATCATGGATTTTAATTTCCGGACGTGATTGCCCGACTAGGTTCCGGAAAGTACCAGGTGCTATAGACTACGAGAACTTCGCCATCTTGGGCAGCATTGGCTCACTGGGTCACTGGGTCACTCCGATCAGATCTGGATTGATTCTTGGACGTGATCGGGACTTCTATCCGATCCAAAGTGTACGACGTGGTACGACGTGTTGAAGCGGCTCTCTGATCCGGAAAGGCTCATCATCAGCAAACAATGCCCCGAGGCGCTGTAGGA

Full Affymetrix probeset data:

Annotations for 1625947_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720