FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625948_at:

>probe:Drosophila_2:1625948_at:634:37; Interrogation_Position=1006; Antisense; ATCTGCCTGACAATGTGGCCGACTT
>probe:Drosophila_2:1625948_at:177:609; Interrogation_Position=1031; Antisense; TGAGAAGGTCTTCGATGCCTCCATT
>probe:Drosophila_2:1625948_at:708:629; Interrogation_Position=1050; Antisense; TCCATTGCAGCCGTGAACAAGCGTT
>probe:Drosophila_2:1625948_at:389:205; Interrogation_Position=1068; Antisense; AAGCGTTACGGTACCACGTACACTG
>probe:Drosophila_2:1625948_at:293:17; Interrogation_Position=1101; Antisense; ATTTACGATGCCATCTACCCAGCGG
>probe:Drosophila_2:1625948_at:723:379; Interrogation_Position=1153; Antisense; GAACCCAGGATGTGCGCATGGCCTT
>probe:Drosophila_2:1625948_at:375:421; Interrogation_Position=1236; Antisense; GAGCAAATCGTACCCGCCAGCGAGG
>probe:Drosophila_2:1625948_at:298:437; Interrogation_Position=1257; Antisense; GAGGAGCTGCTTGACTCCATCGTGG
>probe:Drosophila_2:1625948_at:451:211; Interrogation_Position=1299; Antisense; AAGAGCCTGGGCTACTTTGACTAAG
>probe:Drosophila_2:1625948_at:77:91; Interrogation_Position=1336; Antisense; AGTACTCACAGCTTTTCGGCATAAC
>probe:Drosophila_2:1625948_at:658:719; Interrogation_Position=875; Antisense; TTCCGCTTTCTCTGAGATCGAGACA
>probe:Drosophila_2:1625948_at:508:155; Interrogation_Position=897; Antisense; ACACTGTCACTGTCCAAGTTCATTG
>probe:Drosophila_2:1625948_at:709:371; Interrogation_Position=929; Antisense; GAAGGGCAAGGTCCAGCTGTACCTC
>probe:Drosophila_2:1625948_at:265:681; Interrogation_Position=990; Antisense; TATGGACACACCTCTGATCTGCCTG

Paste this into a BLAST search page for me
ATCTGCCTGACAATGTGGCCGACTTTGAGAAGGTCTTCGATGCCTCCATTTCCATTGCAGCCGTGAACAAGCGTTAAGCGTTACGGTACCACGTACACTGATTTACGATGCCATCTACCCAGCGGGAACCCAGGATGTGCGCATGGCCTTGAGCAAATCGTACCCGCCAGCGAGGGAGGAGCTGCTTGACTCCATCGTGGAAGAGCCTGGGCTACTTTGACTAAGAGTACTCACAGCTTTTCGGCATAACTTCCGCTTTCTCTGAGATCGAGACAACACTGTCACTGTCCAAGTTCATTGGAAGGGCAAGGTCCAGCTGTACCTCTATGGACACACCTCTGATCTGCCTG

Full Affymetrix probeset data:

Annotations for 1625948_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720