FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625949_at:

>probe:Drosophila_2:1625949_at:338:261; Interrogation_Position=1476; Antisense; CACCCTGAGCATATGGATACGTCCA
>probe:Drosophila_2:1625949_at:658:679; Interrogation_Position=1487; Antisense; TATGGATACGTCCATCATGCCGTCG
>probe:Drosophila_2:1625949_at:620:267; Interrogation_Position=1502; Antisense; CATGCCGTCGCCAAAACTTTAAACT
>probe:Drosophila_2:1625949_at:290:511; Interrogation_Position=1527; Antisense; GTGTTACACCCAAACAAGATCAGTC
>probe:Drosophila_2:1625949_at:317:33; Interrogation_Position=1587; Antisense; ATCAAATCAACCAGTCATCTTCACC
>probe:Drosophila_2:1625949_at:199:89; Interrogation_Position=1599; Antisense; AGTCATCTTCACCAAGGCCTATAAA
>probe:Drosophila_2:1625949_at:26:311; Interrogation_Position=1610; Antisense; CCAAGGCCTATAAAGCTGGCATTAT
>probe:Drosophila_2:1625949_at:51:181; Interrogation_Position=1658; Antisense; AAAATCGTTCCACGTCAACTGCATT
>probe:Drosophila_2:1625949_at:142:495; Interrogation_Position=1671; Antisense; GTCAACTGCATTACTTTTTCCTCTA
>probe:Drosophila_2:1625949_at:589:703; Interrogation_Position=1681; Antisense; TTACTTTTTCCTCTAATTCTCGCAA
>probe:Drosophila_2:1625949_at:612:11; Interrogation_Position=1696; Antisense; ATTCTCGCAAGTGTTTTTCAATGTG
>probe:Drosophila_2:1625949_at:430:157; Interrogation_Position=1814; Antisense; ACAAGTTCTTTGTACATACCAACCA
>probe:Drosophila_2:1625949_at:77:223; Interrogation_Position=1833; Antisense; CAACCAAAAGTGTTCCCAACTCATT
>probe:Drosophila_2:1625949_at:420:161; Interrogation_Position=1867; Antisense; AAATTGGCAGCTGCAAATCGGCAAA

Paste this into a BLAST search page for me
CACCCTGAGCATATGGATACGTCCATATGGATACGTCCATCATGCCGTCGCATGCCGTCGCCAAAACTTTAAACTGTGTTACACCCAAACAAGATCAGTCATCAAATCAACCAGTCATCTTCACCAGTCATCTTCACCAAGGCCTATAAACCAAGGCCTATAAAGCTGGCATTATAAAATCGTTCCACGTCAACTGCATTGTCAACTGCATTACTTTTTCCTCTATTACTTTTTCCTCTAATTCTCGCAAATTCTCGCAAGTGTTTTTCAATGTGACAAGTTCTTTGTACATACCAACCACAACCAAAAGTGTTCCCAACTCATTAAATTGGCAGCTGCAAATCGGCAAA

Full Affymetrix probeset data:

Annotations for 1625949_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720