FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625951_at:

>probe:Drosophila_2:1625951_at:229:103; Interrogation_Position=1011; Antisense; AGACCGTACATATTTAGGCCACACA
>probe:Drosophila_2:1625951_at:6:581; Interrogation_Position=1027; Antisense; GGCCACACACAATGGTTATTCTTGT
>probe:Drosophila_2:1625951_at:653:231; Interrogation_Position=569; Antisense; AATGACCCTATTGATTGGCCTCCCT
>probe:Drosophila_2:1625951_at:652:305; Interrogation_Position=587; Antisense; CCTCCCTGGCGAATAGGTGCGGTAA
>probe:Drosophila_2:1625951_at:510:599; Interrogation_Position=633; Antisense; TGTAGGGACTAAATTGGCACCAATC
>probe:Drosophila_2:1625951_at:635:567; Interrogation_Position=648; Antisense; GGCACCAATCTGAAGCAATCAACTG
>probe:Drosophila_2:1625951_at:638:191; Interrogation_Position=676; Antisense; AACTATATATCGCAAGCCCACTCCA
>probe:Drosophila_2:1625951_at:344:321; Interrogation_Position=691; Antisense; GCCCACTCCAAGCATTTAGACTCGG
>probe:Drosophila_2:1625951_at:304:389; Interrogation_Position=755; Antisense; GAAAACCACACCCATTGTATGCGAA
>probe:Drosophila_2:1625951_at:478:533; Interrogation_Position=795; Antisense; GGTGTTTTATTCCAGTGATAGGCAG
>probe:Drosophila_2:1625951_at:332:387; Interrogation_Position=827; Antisense; GAAAACTCACTGCTCTAAGAACACA
>probe:Drosophila_2:1625951_at:96:25; Interrogation_Position=893; Antisense; ATATGCGTTCTTTAGGACGAACCGG
>probe:Drosophila_2:1625951_at:50:381; Interrogation_Position=911; Antisense; GAACCGGAATGTCTGAATGCACTTT
>probe:Drosophila_2:1625951_at:528:363; Interrogation_Position=925; Antisense; GAATGCACTTTTCCAAATTTTGCCT

Paste this into a BLAST search page for me
AGACCGTACATATTTAGGCCACACAGGCCACACACAATGGTTATTCTTGTAATGACCCTATTGATTGGCCTCCCTCCTCCCTGGCGAATAGGTGCGGTAATGTAGGGACTAAATTGGCACCAATCGGCACCAATCTGAAGCAATCAACTGAACTATATATCGCAAGCCCACTCCAGCCCACTCCAAGCATTTAGACTCGGGAAAACCACACCCATTGTATGCGAAGGTGTTTTATTCCAGTGATAGGCAGGAAAACTCACTGCTCTAAGAACACAATATGCGTTCTTTAGGACGAACCGGGAACCGGAATGTCTGAATGCACTTTGAATGCACTTTTCCAAATTTTGCCT

Full Affymetrix probeset data:

Annotations for 1625951_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720