FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625953_at:

>probe:Drosophila_2:1625953_at:386:433; Interrogation_Position=224; Antisense; GAGTGTCCAATTCCGTTGCCAACAG
>probe:Drosophila_2:1625953_at:375:269; Interrogation_Position=269; Antisense; CATCGTCACCACGTAACCAATGGAA
>probe:Drosophila_2:1625953_at:634:159; Interrogation_Position=317; Antisense; ACAACGGTTACTATCGCATCATGCC
>probe:Drosophila_2:1625953_at:652:65; Interrogation_Position=350; Antisense; ATGGTCAGATTGTCGAGGGTCCACA
>probe:Drosophila_2:1625953_at:466:535; Interrogation_Position=367; Antisense; GGTCCACAGTCCAGTGCAGAGGAAT
>probe:Drosophila_2:1625953_at:510:45; Interrogation_Position=390; Antisense; ATCCCACGAGATTTCCCAAGAGTTT
>probe:Drosophila_2:1625953_at:82:429; Interrogation_Position=409; Antisense; GAGTTTTCTCATGAGATTTCCCAGA
>probe:Drosophila_2:1625953_at:670:575; Interrogation_Position=448; Antisense; GGCGAAGATCAATACCACCAGGAGG
>probe:Drosophila_2:1625953_at:472:97; Interrogation_Position=507; Antisense; AGATCTTTCAGAGGACCAGCTTGAT
>probe:Drosophila_2:1625953_at:276:375; Interrogation_Position=571; Antisense; GAAGATGGCCATGACCAATCCGAGG
>probe:Drosophila_2:1625953_at:412:445; Interrogation_Position=613; Antisense; GATGAACTGATCGATCCCGAGGAAG
>probe:Drosophila_2:1625953_at:312:375; Interrogation_Position=634; Antisense; GAAGATGCTATTGACCAGGTTCTAG
>probe:Drosophila_2:1625953_at:49:73; Interrogation_Position=698; Antisense; AGGCACTGAGCCTTATTGAAAGTTT
>probe:Drosophila_2:1625953_at:371:175; Interrogation_Position=730; Antisense; AAACCACTCCACTACATGTTACATT

Paste this into a BLAST search page for me
GAGTGTCCAATTCCGTTGCCAACAGCATCGTCACCACGTAACCAATGGAAACAACGGTTACTATCGCATCATGCCATGGTCAGATTGTCGAGGGTCCACAGGTCCACAGTCCAGTGCAGAGGAATATCCCACGAGATTTCCCAAGAGTTTGAGTTTTCTCATGAGATTTCCCAGAGGCGAAGATCAATACCACCAGGAGGAGATCTTTCAGAGGACCAGCTTGATGAAGATGGCCATGACCAATCCGAGGGATGAACTGATCGATCCCGAGGAAGGAAGATGCTATTGACCAGGTTCTAGAGGCACTGAGCCTTATTGAAAGTTTAAACCACTCCACTACATGTTACATT

Full Affymetrix probeset data:

Annotations for 1625953_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720