FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625954_at:

>probe:Drosophila_2:1625954_at:340:493; Interrogation_Position=1709; Antisense; GTCAACGTGAAGAGCGTGCCGACCA
>probe:Drosophila_2:1625954_at:96:507; Interrogation_Position=1724; Antisense; GTGCCGACCAACATGATCATTACGC
>probe:Drosophila_2:1625954_at:314:453; Interrogation_Position=1738; Antisense; GATCATTACGCGCACCTACAAGGAG
>probe:Drosophila_2:1625954_at:390:67; Interrogation_Position=1761; Antisense; AGGCCATCGGCGAGGTGACCAAAGC
>probe:Drosophila_2:1625954_at:99:611; Interrogation_Position=1776; Antisense; TGACCAAAGCGGATGTGGCCAGTCC
>probe:Drosophila_2:1625954_at:201:623; Interrogation_Position=1923; Antisense; TGCGGAACACTCTGAACGATGCCAC
>probe:Drosophila_2:1625954_at:21:229; Interrogation_Position=1997; Antisense; AATGGCGACGATAAGCTCTCCCAGT
>probe:Drosophila_2:1625954_at:142:171; Interrogation_Position=2047; Antisense; AAAGGTGTCGGATTCGCTGCGAAGA
>probe:Drosophila_2:1625954_at:51:325; Interrogation_Position=2065; Antisense; GCGAAGAAGCTTCCGGGCACTCAAG
>probe:Drosophila_2:1625954_at:63:457; Interrogation_Position=2093; Antisense; GATATCGTGGAGCTGCGCCCGTTCA
>probe:Drosophila_2:1625954_at:718:127; Interrogation_Position=2144; Antisense; ACCTCTCCGGTCCAAAGCAATGGCA
>probe:Drosophila_2:1625954_at:534:251; Interrogation_Position=2167; Antisense; CAAGTAGTGATTCCGTGTGTGTGCC
>probe:Drosophila_2:1625954_at:265:517; Interrogation_Position=2183; Antisense; GTGTGTGCCTTTTCTAATTCGTCAA
>probe:Drosophila_2:1625954_at:292:189; Interrogation_Position=2196; Antisense; CTAATTCGTCAACAGTCGCAAGAGT

Paste this into a BLAST search page for me
GTCAACGTGAAGAGCGTGCCGACCAGTGCCGACCAACATGATCATTACGCGATCATTACGCGCACCTACAAGGAGAGGCCATCGGCGAGGTGACCAAAGCTGACCAAAGCGGATGTGGCCAGTCCTGCGGAACACTCTGAACGATGCCACAATGGCGACGATAAGCTCTCCCAGTAAAGGTGTCGGATTCGCTGCGAAGAGCGAAGAAGCTTCCGGGCACTCAAGGATATCGTGGAGCTGCGCCCGTTCAACCTCTCCGGTCCAAAGCAATGGCACAAGTAGTGATTCCGTGTGTGTGCCGTGTGTGCCTTTTCTAATTCGTCAACTAATTCGTCAACAGTCGCAAGAGT

Full Affymetrix probeset data:

Annotations for 1625954_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720