FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625956_at:

>probe:Drosophila_2:1625956_at:635:77; Interrogation_Position=194; Antisense; AGGATGTGCCCGACAAATATGTGAC
>probe:Drosophila_2:1625956_at:164:243; Interrogation_Position=209; Antisense; AATATGTGACGGCACTCTCGCACTT
>probe:Drosophila_2:1625956_at:255:407; Interrogation_Position=238; Antisense; GACTGGCATTCCAATGGCACGGTTG
>probe:Drosophila_2:1625956_at:557:555; Interrogation_Position=253; Antisense; GGCACGGTTGACATGGAGCGACTTA
>probe:Drosophila_2:1625956_at:602:677; Interrogation_Position=275; Antisense; TTAGTGGTCCCATCCTAAAGTCCAG
>probe:Drosophila_2:1625956_at:729:219; Interrogation_Position=292; Antisense; AAGTCCAGCATCAAGTCGGTCTATT
>probe:Drosophila_2:1625956_at:264:691; Interrogation_Position=313; Antisense; TATTGGCTGTTTCTCATCCAGTACG
>probe:Drosophila_2:1625956_at:200:143; Interrogation_Position=351; Antisense; ACTGGGCGTGGTGCTCAATGTGATC
>probe:Drosophila_2:1625956_at:138:161; Interrogation_Position=407; Antisense; ACAAGGATGTGACCCATGCGTTCAT
>probe:Drosophila_2:1625956_at:47:51; Interrogation_Position=422; Antisense; ATGCGTTCATCATCAATCTGGCCCT
>probe:Drosophila_2:1625956_at:29:583; Interrogation_Position=440; Antisense; TGGCCCTATGCCATTTTGTCCAGTG
>probe:Drosophila_2:1625956_at:635:65; Interrogation_Position=490; Antisense; ATGGTCATGCTCATCCAGAACTGGA
>probe:Drosophila_2:1625956_at:488:545; Interrogation_Position=512; Antisense; GGATCTTTGGCCAGTTTCTGTGCTT
>probe:Drosophila_2:1625956_at:486:117; Interrogation_Position=612; Antisense; AGCTCAGAGCTATATTTATCCCATT

Paste this into a BLAST search page for me
AGGATGTGCCCGACAAATATGTGACAATATGTGACGGCACTCTCGCACTTGACTGGCATTCCAATGGCACGGTTGGGCACGGTTGACATGGAGCGACTTATTAGTGGTCCCATCCTAAAGTCCAGAAGTCCAGCATCAAGTCGGTCTATTTATTGGCTGTTTCTCATCCAGTACGACTGGGCGTGGTGCTCAATGTGATCACAAGGATGTGACCCATGCGTTCATATGCGTTCATCATCAATCTGGCCCTTGGCCCTATGCCATTTTGTCCAGTGATGGTCATGCTCATCCAGAACTGGAGGATCTTTGGCCAGTTTCTGTGCTTAGCTCAGAGCTATATTTATCCCATT

Full Affymetrix probeset data:

Annotations for 1625956_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720