FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625957_at:

>probe:Drosophila_2:1625957_at:3:347; Interrogation_Position=2192; Antisense; GCAGAACCGTACTGTGGACTTCCAT
>probe:Drosophila_2:1625957_at:8:393; Interrogation_Position=2242; Antisense; GAAAGACTCTGCTCGTTGGATCTAC
>probe:Drosophila_2:1625957_at:396:613; Interrogation_Position=2289; Antisense; TGAACATAAACCTTACCCAGCTGTC
>probe:Drosophila_2:1625957_at:378:427; Interrogation_Position=2348; Antisense; GAGTACAACCTGAGGGCCAGCGATC
>probe:Drosophila_2:1625957_at:304:313; Interrogation_Position=2363; Antisense; GCCAGCGATCGCGTTATGATGTACA
>probe:Drosophila_2:1625957_at:482:443; Interrogation_Position=2380; Antisense; GATGTACATAGATCCGCTTGACAAT
>probe:Drosophila_2:1625957_at:637:399; Interrogation_Position=2413; Antisense; GACAGATTGGTCCTTCGATCATACA
>probe:Drosophila_2:1625957_at:687:281; Interrogation_Position=2460; Antisense; CTCCCTATCTGATCTATGCCATATA
>probe:Drosophila_2:1625957_at:691:47; Interrogation_Position=2475; Antisense; ATGCCATATACTCCCAAACCGAGGA
>probe:Drosophila_2:1625957_at:711:73; Interrogation_Position=2496; Antisense; AGGAGCCGCTCAACTTTTGGGTGGA
>probe:Drosophila_2:1625957_at:10:265; Interrogation_Position=2544; Antisense; CAGACGGACCCTACATGAAGCTGGT
>probe:Drosophila_2:1625957_at:151:615; Interrogation_Position=2559; Antisense; TGAAGCTGGTCGTATCCGAGCACTT
>probe:Drosophila_2:1625957_at:275:27; Interrogation_Position=2587; Antisense; ATACCATCCAGAGTACTACACCGAG
>probe:Drosophila_2:1625957_at:451:287; Interrogation_Position=2670; Antisense; CGGCCCTCGAGAGCTGGATTGTTTA

Paste this into a BLAST search page for me
GCAGAACCGTACTGTGGACTTCCATGAAAGACTCTGCTCGTTGGATCTACTGAACATAAACCTTACCCAGCTGTCGAGTACAACCTGAGGGCCAGCGATCGCCAGCGATCGCGTTATGATGTACAGATGTACATAGATCCGCTTGACAATGACAGATTGGTCCTTCGATCATACACTCCCTATCTGATCTATGCCATATAATGCCATATACTCCCAAACCGAGGAAGGAGCCGCTCAACTTTTGGGTGGACAGACGGACCCTACATGAAGCTGGTTGAAGCTGGTCGTATCCGAGCACTTATACCATCCAGAGTACTACACCGAGCGGCCCTCGAGAGCTGGATTGTTTA

Full Affymetrix probeset data:

Annotations for 1625957_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720