FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625959_at:

>probe:Drosophila_2:1625959_at:724:537; Interrogation_Position=1011; Antisense; GGTCAATCGACGTGGCATCTATGCC
>probe:Drosophila_2:1625959_at:299:405; Interrogation_Position=1049; Antisense; GACTCGACGAGTTCCATTTTGTGGT
>probe:Drosophila_2:1625959_at:86:227; Interrogation_Position=1084; Antisense; AAGGAATACCTCAGCATGGCGCGGG
>probe:Drosophila_2:1625959_at:459:439; Interrogation_Position=1150; Antisense; GATGGTGGCCCCAAAGGACTGTTTC
>probe:Drosophila_2:1625959_at:128:183; Interrogation_Position=620; Antisense; AAAACTGTGGGCCATATTCACCCCT
>probe:Drosophila_2:1625959_at:176:295; Interrogation_Position=648; Antisense; CGAGCACATGCATCAGCATCCGATG
>probe:Drosophila_2:1625959_at:159:23; Interrogation_Position=681; Antisense; ATATGCCATCATACAGGGTCAACAC
>probe:Drosophila_2:1625959_at:628:81; Interrogation_Position=695; Antisense; AGGGTCAACACGATCAGCTGGCCTT
>probe:Drosophila_2:1625959_at:247:539; Interrogation_Position=739; Antisense; GGTAAATTCCATGTGGCCAGCCAAT
>probe:Drosophila_2:1625959_at:653:305; Interrogation_Position=814; Antisense; CCTGGTGCTGGGATTTATGCGGATA
>probe:Drosophila_2:1625959_at:345:309; Interrogation_Position=860; Antisense; CCAGTGGCGATGGTGATGTCCTGAT
>probe:Drosophila_2:1625959_at:205:721; Interrogation_Position=901; Antisense; TTCCTGGCCGTCGAAGCAATGCGAG
>probe:Drosophila_2:1625959_at:623:73; Interrogation_Position=932; Antisense; AGGAACCAGACAAGGCAGCCGAGTT
>probe:Drosophila_2:1625959_at:701:509; Interrogation_Position=961; Antisense; GTGCAACGCCTGCTGAGGCACAATA

Paste this into a BLAST search page for me
GGTCAATCGACGTGGCATCTATGCCGACTCGACGAGTTCCATTTTGTGGTAAGGAATACCTCAGCATGGCGCGGGGATGGTGGCCCCAAAGGACTGTTTCAAAACTGTGGGCCATATTCACCCCTCGAGCACATGCATCAGCATCCGATGATATGCCATCATACAGGGTCAACACAGGGTCAACACGATCAGCTGGCCTTGGTAAATTCCATGTGGCCAGCCAATCCTGGTGCTGGGATTTATGCGGATACCAGTGGCGATGGTGATGTCCTGATTTCCTGGCCGTCGAAGCAATGCGAGAGGAACCAGACAAGGCAGCCGAGTTGTGCAACGCCTGCTGAGGCACAATA

Full Affymetrix probeset data:

Annotations for 1625959_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720