FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625960_at:

>probe:Drosophila_2:1625960_at:318:181; Interrogation_Position=2279; Antisense; AAAAATAGCAGGATCACTCTCTTCT
>probe:Drosophila_2:1625960_at:538:453; Interrogation_Position=2290; Antisense; GATCACTCTCTTCTATCATCGTAAA
>probe:Drosophila_2:1625960_at:39:511; Interrogation_Position=2340; Antisense; GTGCAGCCAACACGAAGTTCACTCA
>probe:Drosophila_2:1625960_at:515:473; Interrogation_Position=2356; Antisense; GTTCACTCACTCTTATTTGTTCTCA
>probe:Drosophila_2:1625960_at:725:599; Interrogation_Position=2373; Antisense; TGTTCTCAAAGTTCAACCAAAGTTT
>probe:Drosophila_2:1625960_at:392:703; Interrogation_Position=2399; Antisense; TTAAGTCTTAGCCAGAACACATTCT
>probe:Drosophila_2:1625960_at:12:381; Interrogation_Position=2413; Antisense; GAACACATTCTACAACTTCCAATTT
>probe:Drosophila_2:1625960_at:312:55; Interrogation_Position=2443; Antisense; ATGAAGAACCCATTGCTGAGATGTT
>probe:Drosophila_2:1625960_at:415:687; Interrogation_Position=2513; Antisense; TATTACGATTATCTGCAAGCATACA
>probe:Drosophila_2:1625960_at:186:279; Interrogation_Position=2718; Antisense; CTAGATTTGCTATTTACTCCTTGAT
>probe:Drosophila_2:1625960_at:589:667; Interrogation_Position=2732; Antisense; TACTCCTTGATGTACGCAAACCACA
>probe:Drosophila_2:1625960_at:575:357; Interrogation_Position=2747; Antisense; GCAAACCACAATACGATCTACACAA
>probe:Drosophila_2:1625960_at:221:39; Interrogation_Position=2762; Antisense; ATCTACACAAGAAGCCACGGAATAT
>probe:Drosophila_2:1625960_at:189:179; Interrogation_Position=2803; Antisense; AAACTACATGCAACACATTCGTATA

Paste this into a BLAST search page for me
AAAAATAGCAGGATCACTCTCTTCTGATCACTCTCTTCTATCATCGTAAAGTGCAGCCAACACGAAGTTCACTCAGTTCACTCACTCTTATTTGTTCTCATGTTCTCAAAGTTCAACCAAAGTTTTTAAGTCTTAGCCAGAACACATTCTGAACACATTCTACAACTTCCAATTTATGAAGAACCCATTGCTGAGATGTTTATTACGATTATCTGCAAGCATACACTAGATTTGCTATTTACTCCTTGATTACTCCTTGATGTACGCAAACCACAGCAAACCACAATACGATCTACACAAATCTACACAAGAAGCCACGGAATATAAACTACATGCAACACATTCGTATA

Full Affymetrix probeset data:

Annotations for 1625960_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720