FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625963_at:

>probe:Drosophila_2:1625963_at:469:299; Interrogation_Position=264; Antisense; CGCCGGCGACGCTTATATAGACGAA
>probe:Drosophila_2:1625963_at:486:41; Interrogation_Position=295; Antisense; ATCGGGTGATACGTGCAACCGTCAA
>probe:Drosophila_2:1625963_at:107:207; Interrogation_Position=379; Antisense; AAGCGAAGCACATATCCCTGCGAAA
>probe:Drosophila_2:1625963_at:115:389; Interrogation_Position=400; Antisense; GAAAACAACGCGATGCTGCCTCCAT
>probe:Drosophila_2:1625963_at:270:551; Interrogation_Position=428; Antisense; GGAGACCTTTGATCTTCTGGAGAAA
>probe:Drosophila_2:1625963_at:328:181; Interrogation_Position=494; Antisense; AAAACTGACCCACATGCGTCTTGTT
>probe:Drosophila_2:1625963_at:590:101; Interrogation_Position=536; Antisense; AGAGACTCAAGCTGGCCATGTCAAG
>probe:Drosophila_2:1625963_at:243:371; Interrogation_Position=569; Antisense; GAAGGTGGCTTCACTTGAATCTCAA
>probe:Drosophila_2:1625963_at:187:45; Interrogation_Position=617; Antisense; ATCCTTGCCAACTCCCAAATTAAAT
>probe:Drosophila_2:1625963_at:60:647; Interrogation_Position=653; Antisense; TCTTGAAATTCGCTCCACATGGGAT
>probe:Drosophila_2:1625963_at:705:117; Interrogation_Position=687; Antisense; AGCTACTGTGGAAGAGGCTCCTCTA
>probe:Drosophila_2:1625963_at:98:101; Interrogation_Position=717; Antisense; AGAGGATGGGTGCTACCGCCAACAA
>probe:Drosophila_2:1625963_at:87:571; Interrogation_Position=762; Antisense; GGCTATCGACTATCCTTAACTTAAT
>probe:Drosophila_2:1625963_at:638:693; Interrogation_Position=799; Antisense; TTTCCAAAGCTCACACTCCTTATAA

Paste this into a BLAST search page for me
CGCCGGCGACGCTTATATAGACGAAATCGGGTGATACGTGCAACCGTCAAAAGCGAAGCACATATCCCTGCGAAAGAAAACAACGCGATGCTGCCTCCATGGAGACCTTTGATCTTCTGGAGAAAAAAACTGACCCACATGCGTCTTGTTAGAGACTCAAGCTGGCCATGTCAAGGAAGGTGGCTTCACTTGAATCTCAAATCCTTGCCAACTCCCAAATTAAATTCTTGAAATTCGCTCCACATGGGATAGCTACTGTGGAAGAGGCTCCTCTAAGAGGATGGGTGCTACCGCCAACAAGGCTATCGACTATCCTTAACTTAATTTTCCAAAGCTCACACTCCTTATAA

Full Affymetrix probeset data:

Annotations for 1625963_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720