Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625964_at:

>probe:Drosophila_2:1625964_at:181:207; Interrogation_Position=3657; Antisense; AAGCTGTTTCATTTCCATGGTGCGA
>probe:Drosophila_2:1625964_at:600:307; Interrogation_Position=3671; Antisense; CCATGGTGCGATTTAGTTCAAGTTT
>probe:Drosophila_2:1625964_at:264:439; Interrogation_Position=3727; Antisense; GAGGCTTAAGCGGAATGCATTGCTC
>probe:Drosophila_2:1625964_at:363:53; Interrogation_Position=3741; Antisense; ATGCATTGCTCAGGGCAGTCGAGTT
>probe:Drosophila_2:1625964_at:199:267; Interrogation_Position=3756; Antisense; CAGTCGAGTTGGGTATTTTGGCCTA
>probe:Drosophila_2:1625964_at:478:577; Interrogation_Position=3775; Antisense; GGCCTATTGCATTAAGTCGAGCTGA
>probe:Drosophila_2:1625964_at:222:365; Interrogation_Position=3844; Antisense; GAATTTCTGGCTAACATGTAGTTTG
>probe:Drosophila_2:1625964_at:332:491; Interrogation_Position=3920; Antisense; GTAACTAGACGTAGCCTCGTTTCTT
>probe:Drosophila_2:1625964_at:78:639; Interrogation_Position=3936; Antisense; TCGTTTCTTCTTACGCTTTGATCTT
>probe:Drosophila_2:1625964_at:376:201; Interrogation_Position=4029; Antisense; AACCTAACCACCCTATGTTTGTATG
>probe:Drosophila_2:1625964_at:581:681; Interrogation_Position=4062; Antisense; TATGTCGTGTGCTTTGTACTTTCAA
>probe:Drosophila_2:1625964_at:499:423; Interrogation_Position=4095; Antisense; GAGACAGACATTAGACGTGACGAGA
>probe:Drosophila_2:1625964_at:726:205; Interrogation_Position=4128; Antisense; AAGCTGAAAACTTTGCACTTGGCGT
>probe:Drosophila_2:1625964_at:393:341; Interrogation_Position=4142; Antisense; GCACTTGGCGTTTACCACTAACTAT

Paste this into a BLAST search page for me
AAGCTGTTTCATTTCCATGGTGCGACCATGGTGCGATTTAGTTCAAGTTTGAGGCTTAAGCGGAATGCATTGCTCATGCATTGCTCAGGGCAGTCGAGTTCAGTCGAGTTGGGTATTTTGGCCTAGGCCTATTGCATTAAGTCGAGCTGAGAATTTCTGGCTAACATGTAGTTTGGTAACTAGACGTAGCCTCGTTTCTTTCGTTTCTTCTTACGCTTTGATCTTAACCTAACCACCCTATGTTTGTATGTATGTCGTGTGCTTTGTACTTTCAAGAGACAGACATTAGACGTGACGAGAAAGCTGAAAACTTTGCACTTGGCGTGCACTTGGCGTTTACCACTAACTAT

Full Affymetrix probeset data:

Annotations for 1625964_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime