FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625966_at:

>probe:Drosophila_2:1625966_at:361:249; Interrogation_Position=332; Antisense; CAATTGTCGGGCAGCAGCTCCCAGG
>probe:Drosophila_2:1625966_at:541:117; Interrogation_Position=347; Antisense; AGCTCCCAGGATGATGCCAGCAGCA
>probe:Drosophila_2:1625966_at:375:111; Interrogation_Position=394; Antisense; AGCAAGTGGCTGTCCGCCCAATAGC
>probe:Drosophila_2:1625966_at:146:243; Interrogation_Position=413; Antisense; AATAGCACAACGACGGGCACTGACA
>probe:Drosophila_2:1625966_at:513:143; Interrogation_Position=431; Antisense; ACTGACACTCCCAAAGCCAAAGATA
>probe:Drosophila_2:1625966_at:723:125; Interrogation_Position=458; Antisense; ACCACCAAGGGAAGGAAGCGGCTCA
>probe:Drosophila_2:1625966_at:623:387; Interrogation_Position=483; Antisense; GAAACATAGAGATACCTCCCGAGCC
>probe:Drosophila_2:1625966_at:538:481; Interrogation_Position=542; Antisense; GTTTGGCTGGACTACGCACAGACGC
>probe:Drosophila_2:1625966_at:464:579; Interrogation_Position=568; Antisense; GGCCAAGCTGCTGGGCGACAACGAT
>probe:Drosophila_2:1625966_at:1:649; Interrogation_Position=624; Antisense; TCACCGACCCGAACCTGAAGATGTT
>probe:Drosophila_2:1625966_at:379:587; Interrogation_Position=657; Antisense; TGGAGCTGCGCCAGATGGCTAAGCA
>probe:Drosophila_2:1625966_at:220:303; Interrogation_Position=762; Antisense; CCCCGCTCACCTAAATATCTAGTTA
>probe:Drosophila_2:1625966_at:325:75; Interrogation_Position=786; Antisense; AGGACCAAATTCGTAGTAGCTCAAA
>probe:Drosophila_2:1625966_at:449:487; Interrogation_Position=801; Antisense; GTAGCTCAAATTTACTCTTGTACTT

Paste this into a BLAST search page for me
CAATTGTCGGGCAGCAGCTCCCAGGAGCTCCCAGGATGATGCCAGCAGCAAGCAAGTGGCTGTCCGCCCAATAGCAATAGCACAACGACGGGCACTGACAACTGACACTCCCAAAGCCAAAGATAACCACCAAGGGAAGGAAGCGGCTCAGAAACATAGAGATACCTCCCGAGCCGTTTGGCTGGACTACGCACAGACGCGGCCAAGCTGCTGGGCGACAACGATTCACCGACCCGAACCTGAAGATGTTTGGAGCTGCGCCAGATGGCTAAGCACCCCGCTCACCTAAATATCTAGTTAAGGACCAAATTCGTAGTAGCTCAAAGTAGCTCAAATTTACTCTTGTACTT

Full Affymetrix probeset data:

Annotations for 1625966_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720