FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625968_at:

>probe:Drosophila_2:1625968_at:201:59; Interrogation_Position=1039; Antisense; ATGATCTCCGTTGGCGTCCAGAAGG
>probe:Drosophila_2:1625968_at:294:225; Interrogation_Position=1060; Antisense; AAGGCTGAAACCTGGCCAGATGACT
>probe:Drosophila_2:1625968_at:8:99; Interrogation_Position=1077; Antisense; AGATGACTGGACTGCTGTGACCGCC
>probe:Drosophila_2:1625968_at:32:489; Interrogation_Position=1110; Antisense; GTACTCCGCCCAGTTTGAGCAGACA
>probe:Drosophila_2:1625968_at:174:397; Interrogation_Position=1131; Antisense; GACACTGCTGGTCAACGAAACCGGA
>probe:Drosophila_2:1625968_at:113:429; Interrogation_Position=1159; Antisense; GAGATTCTCACCAAGCGTCGCGAGA
>probe:Drosophila_2:1625968_at:438:141; Interrogation_Position=1187; Antisense; ACGGACAGCCGTGGTTCATGGACAA
>probe:Drosophila_2:1625968_at:140:433; Interrogation_Position=1217; Antisense; GAGGGTCGACCAACTTGGGCTAATA
>probe:Drosophila_2:1625968_at:133:571; Interrogation_Position=733; Antisense; GGCTTCCATGGTGATCTCAACGAGA
>probe:Drosophila_2:1625968_at:307:227; Interrogation_Position=826; Antisense; AAGGCCATTGAGTTCGTGCGTCCGG
>probe:Drosophila_2:1625968_at:700:63; Interrogation_Position=890; Antisense; ATGTGGCACCACATGGATTCAGCGT
>probe:Drosophila_2:1625968_at:458:461; Interrogation_Position=905; Antisense; GATTCAGCGTGGTGCGCAGCTATTG
>probe:Drosophila_2:1625968_at:160:115; Interrogation_Position=922; Antisense; AGCTATTGCGGTCATGGCATTCACC
>probe:Drosophila_2:1625968_at:646:505; Interrogation_Position=970; Antisense; GTGCCTCACTATGCCAAAAACTCTG

Paste this into a BLAST search page for me
ATGATCTCCGTTGGCGTCCAGAAGGAAGGCTGAAACCTGGCCAGATGACTAGATGACTGGACTGCTGTGACCGCCGTACTCCGCCCAGTTTGAGCAGACAGACACTGCTGGTCAACGAAACCGGAGAGATTCTCACCAAGCGTCGCGAGAACGGACAGCCGTGGTTCATGGACAAGAGGGTCGACCAACTTGGGCTAATAGGCTTCCATGGTGATCTCAACGAGAAAGGCCATTGAGTTCGTGCGTCCGGATGTGGCACCACATGGATTCAGCGTGATTCAGCGTGGTGCGCAGCTATTGAGCTATTGCGGTCATGGCATTCACCGTGCCTCACTATGCCAAAAACTCTG

Full Affymetrix probeset data:

Annotations for 1625968_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720