FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625970_at:

>probe:Drosophila_2:1625970_at:507:165; Interrogation_Position=6084; Antisense; AAATCGGCTATGAAATGGTTTGAAA
>probe:Drosophila_2:1625970_at:329:723; Interrogation_Position=6103; Antisense; TTGAAATGGGTTTGCTTGCTCCGAT
>probe:Drosophila_2:1625970_at:544:619; Interrogation_Position=6119; Antisense; TGCTCCGATCGCTGGACGAAGGGAA
>probe:Drosophila_2:1625970_at:640:171; Interrogation_Position=6146; Antisense; AAAGAATTTCAAGAGTGCCTAGACT
>probe:Drosophila_2:1625970_at:72:215; Interrogation_Position=6156; Antisense; AAGAGTGCCTAGACTTGCCCTCCAT
>probe:Drosophila_2:1625970_at:79:401; Interrogation_Position=6176; Antisense; TCCATCCCCACCATAGTAATAAGCG
>probe:Drosophila_2:1625970_at:133:273; Interrogation_Position=6213; Antisense; CATTTATTTTTTGTATCCACTTTGT
>probe:Drosophila_2:1625970_at:263:441; Interrogation_Position=6320; Antisense; GATGGATGTCACAAATATTTGCGTA
>probe:Drosophila_2:1625970_at:611:19; Interrogation_Position=6336; Antisense; ATTTGCGTAGATTTTTCTCGACTAA
>probe:Drosophila_2:1625970_at:210:695; Interrogation_Position=6349; Antisense; TTTCTCGACTAAAAGTCTATGGCTA
>probe:Drosophila_2:1625970_at:64:163; Interrogation_Position=6405; Antisense; AAATTTTTGCCATATATCTTACATA
>probe:Drosophila_2:1625970_at:279:663; Interrogation_Position=6527; Antisense; TAAAGCAAATCGTTAAAGCATCCAA
>probe:Drosophila_2:1625970_at:103:209; Interrogation_Position=6542; Antisense; AAGCATCCAACAATCGTATACGATA
>probe:Drosophila_2:1625970_at:216:27; Interrogation_Position=6559; Antisense; ATACGATAAGTAAAAGTCCTGCAGA

Paste this into a BLAST search page for me
AAATCGGCTATGAAATGGTTTGAAATTGAAATGGGTTTGCTTGCTCCGATTGCTCCGATCGCTGGACGAAGGGAAAAAGAATTTCAAGAGTGCCTAGACTAAGAGTGCCTAGACTTGCCCTCCATTCCATCCCCACCATAGTAATAAGCGCATTTATTTTTTGTATCCACTTTGTGATGGATGTCACAAATATTTGCGTAATTTGCGTAGATTTTTCTCGACTAATTTCTCGACTAAAAGTCTATGGCTAAAATTTTTGCCATATATCTTACATATAAAGCAAATCGTTAAAGCATCCAAAAGCATCCAACAATCGTATACGATAATACGATAAGTAAAAGTCCTGCAGA

Full Affymetrix probeset data:

Annotations for 1625970_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720