Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625972_at:

>probe:Drosophila_2:1625972_at:85:241; Interrogation_Position=2383; Antisense; AATCAAGTTTGTACTGGCCGGAATG
>probe:Drosophila_2:1625972_at:701:577; Interrogation_Position=2398; Antisense; GGCCGGAATGACATTTGCACCAATA
>probe:Drosophila_2:1625972_at:349:599; Interrogation_Position=2440; Antisense; TGTACTACCGTTAATTGTCCACTTG
>probe:Drosophila_2:1625972_at:433:201; Interrogation_Position=2491; Antisense; AACCGGTGCCGCCAGAATCTTAACT
>probe:Drosophila_2:1625972_at:543:375; Interrogation_Position=2527; Antisense; GAAGAATGTTACACCCAACCGTCAG
>probe:Drosophila_2:1625972_at:514:309; Interrogation_Position=2541; Antisense; CCAACCGTCAGCTTTCACATATAAT
>probe:Drosophila_2:1625972_at:460:479; Interrogation_Position=2578; Antisense; GTTTCTAAGCTAATGATACCTCCAG
>probe:Drosophila_2:1625972_at:13:457; Interrogation_Position=2592; Antisense; GATACCTCCAGATGGTCGTACCATA
>probe:Drosophila_2:1625972_at:167:667; Interrogation_Position=2619; Antisense; TACATTGAGAGGTCCACTTTGGTAT
>probe:Drosophila_2:1625972_at:337:713; Interrogation_Position=2672; Antisense; TTCGCATACAAGCAACCACCAATAT
>probe:Drosophila_2:1625972_at:620:357; Interrogation_Position=2704; Antisense; GCAACCGATGGGAGTTTTGACACTT
>probe:Drosophila_2:1625972_at:169:235; Interrogation_Position=2765; Antisense; AATCACTGGAGGGACCCCAGGACAT
>probe:Drosophila_2:1625972_at:434:489; Interrogation_Position=2814; Antisense; GTACACAAACGGAATGCCTCGTGGA
>probe:Drosophila_2:1625972_at:37:693; Interrogation_Position=2903; Antisense; TTTGCTGCGAACATGTATACCTTTA

Paste this into a BLAST search page for me
AATCAAGTTTGTACTGGCCGGAATGGGCCGGAATGACATTTGCACCAATATGTACTACCGTTAATTGTCCACTTGAACCGGTGCCGCCAGAATCTTAACTGAAGAATGTTACACCCAACCGTCAGCCAACCGTCAGCTTTCACATATAATGTTTCTAAGCTAATGATACCTCCAGGATACCTCCAGATGGTCGTACCATATACATTGAGAGGTCCACTTTGGTATTTCGCATACAAGCAACCACCAATATGCAACCGATGGGAGTTTTGACACTTAATCACTGGAGGGACCCCAGGACATGTACACAAACGGAATGCCTCGTGGATTTGCTGCGAACATGTATACCTTTA

Full Affymetrix probeset data:

Annotations for 1625972_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime