FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625974_at:

>probe:Drosophila_2:1625974_at:431:563; Interrogation_Position=1911; Antisense; GGAATTCGCAAAATCTCGTTTCAAG
>probe:Drosophila_2:1625974_at:28:575; Interrogation_Position=1948; Antisense; GGCGAGGCTAGACATCTGCCCAAGT
>probe:Drosophila_2:1625974_at:552:321; Interrogation_Position=1965; Antisense; GCCCAAGTCTATCGATCACATGCAT
>probe:Drosophila_2:1625974_at:703:631; Interrogation_Position=2018; Antisense; TCCCGGTCCTTCTACAACAATTTTG
>probe:Drosophila_2:1625974_at:156:443; Interrogation_Position=2079; Antisense; GATGTTGATGTCAGCCTCAAGCACA
>probe:Drosophila_2:1625974_at:38:131; Interrogation_Position=2106; Antisense; ACCTCCGAAGCTTGAGCTAAGCGCA
>probe:Drosophila_2:1625974_at:483:327; Interrogation_Position=2131; Antisense; GCGATGGACCGCCTAGCTATAAGCT
>probe:Drosophila_2:1625974_at:47:675; Interrogation_Position=2144; Antisense; TAGCTATAAGCTCTGGCTCACCCAG
>probe:Drosophila_2:1625974_at:7:119; Interrogation_Position=2167; Antisense; AGCTCGGATCCATTTGACTCTCTAC
>probe:Drosophila_2:1625974_at:415:403; Interrogation_Position=2182; Antisense; GACTCTCTACGCACGATAAACGCTA
>probe:Drosophila_2:1625974_at:139:15; Interrogation_Position=2264; Antisense; ATTAGTGTGCATTCTGGTCGACCAT
>probe:Drosophila_2:1625974_at:173:201; Interrogation_Position=2312; Antisense; AACCGCATAAATATTTCTCCATTCG
>probe:Drosophila_2:1625974_at:592:293; Interrogation_Position=2358; Antisense; CGATTTTTTGTTATTGCCCGCTTAT
>probe:Drosophila_2:1625974_at:279:321; Interrogation_Position=2373; Antisense; GCCCGCTTATCCAATTAATTAGCTT

Paste this into a BLAST search page for me
GGAATTCGCAAAATCTCGTTTCAAGGGCGAGGCTAGACATCTGCCCAAGTGCCCAAGTCTATCGATCACATGCATTCCCGGTCCTTCTACAACAATTTTGGATGTTGATGTCAGCCTCAAGCACAACCTCCGAAGCTTGAGCTAAGCGCAGCGATGGACCGCCTAGCTATAAGCTTAGCTATAAGCTCTGGCTCACCCAGAGCTCGGATCCATTTGACTCTCTACGACTCTCTACGCACGATAAACGCTAATTAGTGTGCATTCTGGTCGACCATAACCGCATAAATATTTCTCCATTCGCGATTTTTTGTTATTGCCCGCTTATGCCCGCTTATCCAATTAATTAGCTT

Full Affymetrix probeset data:

Annotations for 1625974_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720