FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625978_at:

>probe:Drosophila_2:1625978_at:386:279; Interrogation_Position=1086; Antisense; CTAAGACGTACGAGGAGCGCGGCAT
>probe:Drosophila_2:1625978_at:3:57; Interrogation_Position=1137; Antisense; ATGAGCAAGGAATCCGGGCACTGGC
>probe:Drosophila_2:1625978_at:568:719; Interrogation_Position=1167; Antisense; TTGACCGGACACAGCAAATCGATGC
>probe:Drosophila_2:1625978_at:549:225; Interrogation_Position=1226; Antisense; AAGGAATACCTGCAGGCATTCGCCG
>probe:Drosophila_2:1625978_at:79:459; Interrogation_Position=1277; Antisense; GATATCAATCGGTTCTTTGCCGGCA
>probe:Drosophila_2:1625978_at:563:625; Interrogation_Position=1294; Antisense; TGCCGGCATGCGCAATGAGAACAAT
>probe:Drosophila_2:1625978_at:331:423; Interrogation_Position=1310; Antisense; GAGAACAATGCCAACCTGGGTCAGC
>probe:Drosophila_2:1625978_at:580:537; Interrogation_Position=1328; Antisense; GGTCAGCCCTATTTCTGTCGCTAAA
>probe:Drosophila_2:1625978_at:182:93; Interrogation_Position=1354; Antisense; AGTTAGCACTCTATATTACTCTAGT
>probe:Drosophila_2:1625978_at:660:707; Interrogation_Position=1369; Antisense; TTACTCTAGTATTACCCACATTCCC
>probe:Drosophila_2:1625978_at:288:219; Interrogation_Position=1492; Antisense; AAGTCGTAACAAGGCATCGGGCAAT
>probe:Drosophila_2:1625978_at:348:427; Interrogation_Position=1517; Antisense; GAGATTCGCATTTCCCTCATTAAAT
>probe:Drosophila_2:1625978_at:132:423; Interrogation_Position=1607; Antisense; GAGACCTTTTTACATGTAGCTCTAA
>probe:Drosophila_2:1625978_at:298:487; Interrogation_Position=1622; Antisense; GTAGCTCTAATTGGTTAATTTCCGA

Paste this into a BLAST search page for me
CTAAGACGTACGAGGAGCGCGGCATATGAGCAAGGAATCCGGGCACTGGCTTGACCGGACACAGCAAATCGATGCAAGGAATACCTGCAGGCATTCGCCGGATATCAATCGGTTCTTTGCCGGCATGCCGGCATGCGCAATGAGAACAATGAGAACAATGCCAACCTGGGTCAGCGGTCAGCCCTATTTCTGTCGCTAAAAGTTAGCACTCTATATTACTCTAGTTTACTCTAGTATTACCCACATTCCCAAGTCGTAACAAGGCATCGGGCAATGAGATTCGCATTTCCCTCATTAAATGAGACCTTTTTACATGTAGCTCTAAGTAGCTCTAATTGGTTAATTTCCGA

Full Affymetrix probeset data:

Annotations for 1625978_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720