Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625980_at:

>probe:Drosophila_2:1625980_at:42:629; Interrogation_Position=1911; Antisense; TCCGTCGCCTGCTGTAGTTACTCCG
>probe:Drosophila_2:1625980_at:647:91; Interrogation_Position=1926; Antisense; AGTTACTCCGCCTCAGAAACAGTCG
>probe:Drosophila_2:1625980_at:669:573; Interrogation_Position=1950; Antisense; GGCGGCTCCCCAAGCGGGAATCAAG
>probe:Drosophila_2:1625980_at:141:187; Interrogation_Position=2027; Antisense; AACAACCGCAAAAGCAGCCACCAGG
>probe:Drosophila_2:1625980_at:538:221; Interrogation_Position=2086; Antisense; AAGGGCGTGCAGAAACAGCCGAACC
>probe:Drosophila_2:1625980_at:638:379; Interrogation_Position=2106; Antisense; GAACCCCAATGCCAAGCCAGCAGTT
>probe:Drosophila_2:1625980_at:442:201; Interrogation_Position=2119; Antisense; AAGCCAGCAGTTGCTCCAAAGCCGG
>probe:Drosophila_2:1625980_at:293:183; Interrogation_Position=2157; Antisense; AAAACCCGCTGCTGCTTCTCCAAAA
>probe:Drosophila_2:1625980_at:422:253; Interrogation_Position=2190; Antisense; CAACCAGACGAATCCACAACAACAG
>probe:Drosophila_2:1625980_at:130:173; Interrogation_Position=2221; Antisense; AAAGCAGCTAACAAAGCGTCTCCTC
>probe:Drosophila_2:1625980_at:27:207; Interrogation_Position=2234; Antisense; AAGCGTCTCCTCCAAAGCAAACTGG
>probe:Drosophila_2:1625980_at:588:331; Interrogation_Position=2284; Antisense; GCGGCGAACGCCTCGAAGGCCACAG
>probe:Drosophila_2:1625980_at:581:293; Interrogation_Position=2315; Antisense; CGAAATCGGCTGCATCCCCAAAAGC
>probe:Drosophila_2:1625980_at:635:369; Interrogation_Position=2349; Antisense; GAAGGCCGGAACTCCTACCAATCCT

Paste this into a BLAST search page for me
TCCGTCGCCTGCTGTAGTTACTCCGAGTTACTCCGCCTCAGAAACAGTCGGGCGGCTCCCCAAGCGGGAATCAAGAACAACCGCAAAAGCAGCCACCAGGAAGGGCGTGCAGAAACAGCCGAACCGAACCCCAATGCCAAGCCAGCAGTTAAGCCAGCAGTTGCTCCAAAGCCGGAAAACCCGCTGCTGCTTCTCCAAAACAACCAGACGAATCCACAACAACAGAAAGCAGCTAACAAAGCGTCTCCTCAAGCGTCTCCTCCAAAGCAAACTGGGCGGCGAACGCCTCGAAGGCCACAGCGAAATCGGCTGCATCCCCAAAAGCGAAGGCCGGAACTCCTACCAATCCT

Full Affymetrix probeset data:

Annotations for 1625980_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime