Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625981_at:

>probe:Drosophila_2:1625981_at:340:511; Interrogation_Position=7458; Antisense; GTGAATATCTACCAGACAACTACGA
>probe:Drosophila_2:1625981_at:296:483; Interrogation_Position=7570; Antisense; GTATGACAGCAAGAAGTGGTCCTAA
>probe:Drosophila_2:1625981_at:373:519; Interrogation_Position=7585; Antisense; GTGGTCCTAAGTTCAGATCTATTGG
>probe:Drosophila_2:1625981_at:251:517; Interrogation_Position=7609; Antisense; GGATCGGTAGTTTAAGGAATTGTCA
>probe:Drosophila_2:1625981_at:568:247; Interrogation_Position=7626; Antisense; AATTGTCAGGGAACACGAGCACGGA
>probe:Drosophila_2:1625981_at:452:151; Interrogation_Position=7638; Antisense; ACACGAGCACGGACGACGGAGAGTT
>probe:Drosophila_2:1625981_at:194:551; Interrogation_Position=7723; Antisense; GGAGATCGGCGTACATCCAAAATAC
>probe:Drosophila_2:1625981_at:260:699; Interrogation_Position=7809; Antisense; TTTTTTGTTAGCTGGCTCTGGATGT
>probe:Drosophila_2:1625981_at:355:121; Interrogation_Position=7818; Antisense; AGCTGGCTCTGGATGTTAACCACAA
>probe:Drosophila_2:1625981_at:471:437; Interrogation_Position=7829; Antisense; GATGTTAACCACAAATAAAGCCCAG
>probe:Drosophila_2:1625981_at:469:663; Interrogation_Position=7844; Antisense; TAAAGCCCAGCACCCATATATATAT
>probe:Drosophila_2:1625981_at:296:21; Interrogation_Position=7869; Antisense; ATATATACATACCTCTTTAGCCGTG
>probe:Drosophila_2:1625981_at:214:131; Interrogation_Position=7879; Antisense; ACCTCTTTAGCCGTGTATATATGTA
>probe:Drosophila_2:1625981_at:638:475; Interrogation_Position=7915; Antisense; GTATTTTTCAAAGTTCAAAGCGAGA

Paste this into a BLAST search page for me
GTGAATATCTACCAGACAACTACGAGTATGACAGCAAGAAGTGGTCCTAAGTGGTCCTAAGTTCAGATCTATTGGGGATCGGTAGTTTAAGGAATTGTCAAATTGTCAGGGAACACGAGCACGGAACACGAGCACGGACGACGGAGAGTTGGAGATCGGCGTACATCCAAAATACTTTTTTGTTAGCTGGCTCTGGATGTAGCTGGCTCTGGATGTTAACCACAAGATGTTAACCACAAATAAAGCCCAGTAAAGCCCAGCACCCATATATATATATATATACATACCTCTTTAGCCGTGACCTCTTTAGCCGTGTATATATGTAGTATTTTTCAAAGTTCAAAGCGAGA

Full Affymetrix probeset data:

Annotations for 1625981_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime