Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625982_at:

>probe:Drosophila_2:1625982_at:415:393; Interrogation_Position=4623; Antisense; GAAAGACAGTCACTTTGCGGGCGCC
>probe:Drosophila_2:1625982_at:231:539; Interrogation_Position=4649; Antisense; GGTAAACTCCGCCAGCTTAACACGG
>probe:Drosophila_2:1625982_at:451:259; Interrogation_Position=4669; Antisense; CACGGACACCGGTCTGTATGTGGGT
>probe:Drosophila_2:1625982_at:606:233; Interrogation_Position=4696; Antisense; AATGCCCGATGTTGGTTACTTCACG
>probe:Drosophila_2:1625982_at:339:121; Interrogation_Position=4725; Antisense; AGCGCTACTTCAGTGGCATCGTCGG
>probe:Drosophila_2:1625982_at:301:43; Interrogation_Position=4742; Antisense; ATCGTCGGCTGCATCTCGGAAATCG
>probe:Drosophila_2:1625982_at:8:503; Interrogation_Position=4766; Antisense; GTCCTGGCCGGCGAAATGAAACTGA
>probe:Drosophila_2:1625982_at:201:613; Interrogation_Position=4788; Antisense; TGAACTTCGATCCTAATACGCTGGG
>probe:Drosophila_2:1625982_at:470:423; Interrogation_Position=4829; Antisense; GAGACGGGCCTCCTATGAAACGCTG
>probe:Drosophila_2:1625982_at:478:135; Interrogation_Position=4855; Antisense; ACGCACGCCTCAAGACTTTTGATAT
>probe:Drosophila_2:1625982_at:320:661; Interrogation_Position=4902; Antisense; TAAACCACACAAATGTCCTTCGTCG
>probe:Drosophila_2:1625982_at:176:503; Interrogation_Position=4916; Antisense; GTCCTTCGTCGATTTGTGTTTGTAC
>probe:Drosophila_2:1625982_at:211:699; Interrogation_Position=5009; Antisense; TTTTTTACACCACGATACGGAGGAG
>probe:Drosophila_2:1625982_at:363:201; Interrogation_Position=5151; Antisense; AACCAAGGCACGCTTCTTGTAGAGC

Paste this into a BLAST search page for me
GAAAGACAGTCACTTTGCGGGCGCCGGTAAACTCCGCCAGCTTAACACGGCACGGACACCGGTCTGTATGTGGGTAATGCCCGATGTTGGTTACTTCACGAGCGCTACTTCAGTGGCATCGTCGGATCGTCGGCTGCATCTCGGAAATCGGTCCTGGCCGGCGAAATGAAACTGATGAACTTCGATCCTAATACGCTGGGGAGACGGGCCTCCTATGAAACGCTGACGCACGCCTCAAGACTTTTGATATTAAACCACACAAATGTCCTTCGTCGGTCCTTCGTCGATTTGTGTTTGTACTTTTTTACACCACGATACGGAGGAGAACCAAGGCACGCTTCTTGTAGAGC

Full Affymetrix probeset data:

Annotations for 1625982_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime