FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625983_at:

>probe:Drosophila_2:1625983_at:110:689; Interrogation_Position=103; Antisense; TATTCCGATCCTACCATCAGTGCAT
>probe:Drosophila_2:1625983_at:559:335; Interrogation_Position=154; Antisense; GCTCCCCGTCCTGATATTTCAAGTG
>probe:Drosophila_2:1625983_at:522:635; Interrogation_Position=184; Antisense; TCGGTTGTCATTGCGTTGCCAAGTA
>probe:Drosophila_2:1625983_at:581:715; Interrogation_Position=194; Antisense; TTGCGTTGCCAAGTAGCGAGACCCT
>probe:Drosophila_2:1625983_at:297:425; Interrogation_Position=211; Antisense; GAGACCCTCGTCGTGACCGAGGAAA
>probe:Drosophila_2:1625983_at:638:405; Interrogation_Position=248; Antisense; GACTCCGGCGAAGAATGAGGTTTCT
>probe:Drosophila_2:1625983_at:530:479; Interrogation_Position=267; Antisense; GTTTCTCGAGTTGCGGCGTGAGCAC
>probe:Drosophila_2:1625983_at:278:575; Interrogation_Position=281; Antisense; GGCGTGAGCACTACAACTACGTCAG
>probe:Drosophila_2:1625983_at:101:193; Interrogation_Position=295; Antisense; AACTACGTCAGCCATAGCGAGCAAT
>probe:Drosophila_2:1625983_at:518:111; Interrogation_Position=314; Antisense; AGCAATGCAACATGGCGGATACGGA
>probe:Drosophila_2:1625983_at:267:455; Interrogation_Position=346; Antisense; GATCACACGGAGAATCACCCAAAGT
>probe:Drosophila_2:1625983_at:539:443; Interrogation_Position=55; Antisense; GATGATTCCAGTGACGACGATGCCA
>probe:Drosophila_2:1625983_at:283:85; Interrogation_Position=64; Antisense; AGTGACGACGATGCCAACCAGAGAG
>probe:Drosophila_2:1625983_at:577:425; Interrogation_Position=84; Antisense; GAGAGCAGTTCGAGATCAGTATTCC

Paste this into a BLAST search page for me
TATTCCGATCCTACCATCAGTGCATGCTCCCCGTCCTGATATTTCAAGTGTCGGTTGTCATTGCGTTGCCAAGTATTGCGTTGCCAAGTAGCGAGACCCTGAGACCCTCGTCGTGACCGAGGAAAGACTCCGGCGAAGAATGAGGTTTCTGTTTCTCGAGTTGCGGCGTGAGCACGGCGTGAGCACTACAACTACGTCAGAACTACGTCAGCCATAGCGAGCAATAGCAATGCAACATGGCGGATACGGAGATCACACGGAGAATCACCCAAAGTGATGATTCCAGTGACGACGATGCCAAGTGACGACGATGCCAACCAGAGAGGAGAGCAGTTCGAGATCAGTATTCC

Full Affymetrix probeset data:

Annotations for 1625983_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720