FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625985_at:

>probe:Drosophila_2:1625985_at:455:621; Interrogation_Position=292; Antisense; TGCTGATCGATACCACATATGCCGT
>probe:Drosophila_2:1625985_at:685:683; Interrogation_Position=316; Antisense; TATCTCCCGATTACCCGTGGGTGAA
>probe:Drosophila_2:1625985_at:18:383; Interrogation_Position=350; Antisense; GAACGCAACCATCACTGTGGAGAAT
>probe:Drosophila_2:1625985_at:199:69; Interrogation_Position=391; Antisense; ATGGCTACAACTTCACCTACTGGAA
>probe:Drosophila_2:1625985_at:91:541; Interrogation_Position=423; Antisense; GGTTATACCACCTATACAGTGTACA
>probe:Drosophila_2:1625985_at:537:29; Interrogation_Position=447; Antisense; AAGGTCCTTTACACTGACTACACCG
>probe:Drosophila_2:1625985_at:580:579; Interrogation_Position=475; Antisense; TGGCCTTCCTTTGTGGCTATACCAA
>probe:Drosophila_2:1625985_at:404:453; Interrogation_Position=507; Antisense; GATAACGGCACATCCTTTGGAATTA
>probe:Drosophila_2:1625985_at:213:15; Interrogation_Position=528; Antisense; ATTATCCTTGCTAGGGATCGTACCC
>probe:Drosophila_2:1625985_at:540:531; Interrogation_Position=581; Antisense; GGGTCTTGGCTCTAGTATATCTTCA
>probe:Drosophila_2:1625985_at:10:229; Interrogation_Position=615; Antisense; AATGGCACCATGTCAGCGATAACTC
>probe:Drosophila_2:1625985_at:333:647; Interrogation_Position=638; Antisense; TCAGGGCGAATCTTGCTATGCACCA
>probe:Drosophila_2:1625985_at:291:235; Interrogation_Position=672; Antisense; AATCCTTCGACCATTATTTCCACAA
>probe:Drosophila_2:1625985_at:231:713; Interrogation_Position=718; Antisense; TTCTTGGCATTTTTGCTGACCATCA

Paste this into a BLAST search page for me
TGCTGATCGATACCACATATGCCGTTATCTCCCGATTACCCGTGGGTGAAGAACGCAACCATCACTGTGGAGAATATGGCTACAACTTCACCTACTGGAAGGTTATACCACCTATACAGTGTACAAAGGTCCTTTACACTGACTACACCGTGGCCTTCCTTTGTGGCTATACCAAGATAACGGCACATCCTTTGGAATTAATTATCCTTGCTAGGGATCGTACCCGGGTCTTGGCTCTAGTATATCTTCAAATGGCACCATGTCAGCGATAACTCTCAGGGCGAATCTTGCTATGCACCAAATCCTTCGACCATTATTTCCACAATTCTTGGCATTTTTGCTGACCATCA

Full Affymetrix probeset data:

Annotations for 1625985_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720