FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625986_at:

>probe:Drosophila_2:1625986_at:361:283; Interrogation_Position=1050; Antisense; CTGCGACGAATGTCCTCGATACGAA
>probe:Drosophila_2:1625986_at:468:603; Interrogation_Position=1077; Antisense; TGATATTCAATCACCTGAGCCAGAA
>probe:Drosophila_2:1625986_at:59:407; Interrogation_Position=657; Antisense; GACGGGTGCTGGTCGTCTTTAAGAC
>probe:Drosophila_2:1625986_at:227:65; Interrogation_Position=687; Antisense; ATGGGTTCCAGGACTATCCCGACTA
>probe:Drosophila_2:1625986_at:602:403; Interrogation_Position=707; Antisense; GACTATCTGCAGAGTCTCGTCGAGA
>probe:Drosophila_2:1625986_at:502:65; Interrogation_Position=731; Antisense; ATGGACGACCTGATCTTCGAGTCGC
>probe:Drosophila_2:1625986_at:186:543; Interrogation_Position=786; Antisense; GGATTACGGTCATTTGTGATCTTCA
>probe:Drosophila_2:1625986_at:519:711; Interrogation_Position=807; Antisense; TTCAAGGGCAATTTTCGCCGGCGTT
>probe:Drosophila_2:1625986_at:390:181; Interrogation_Position=851; Antisense; AAGAACGGAGTTCTGCCCTTCAGTC
>probe:Drosophila_2:1625986_at:52:713; Interrogation_Position=869; Antisense; TTCAGTCAGCGCATCGTGCATATAA
>probe:Drosophila_2:1625986_at:350:197; Interrogation_Position=897; Antisense; AACGAGGTTTCCTGATGCACGTAAC
>probe:Drosophila_2:1625986_at:716:353; Interrogation_Position=913; Antisense; GCACGTAACCTCCACTTTGTTTATG
>probe:Drosophila_2:1625986_at:627:387; Interrogation_Position=962; Antisense; GAAAAGATCTTTACCCACGATGGGC
>probe:Drosophila_2:1625986_at:106:65; Interrogation_Position=981; Antisense; ATGGGCGACATCTGAGCAAGCTGCG

Paste this into a BLAST search page for me
CTGCGACGAATGTCCTCGATACGAATGATATTCAATCACCTGAGCCAGAAGACGGGTGCTGGTCGTCTTTAAGACATGGGTTCCAGGACTATCCCGACTAGACTATCTGCAGAGTCTCGTCGAGAATGGACGACCTGATCTTCGAGTCGCGGATTACGGTCATTTGTGATCTTCATTCAAGGGCAATTTTCGCCGGCGTTAAGAACGGAGTTCTGCCCTTCAGTCTTCAGTCAGCGCATCGTGCATATAAAACGAGGTTTCCTGATGCACGTAACGCACGTAACCTCCACTTTGTTTATGGAAAAGATCTTTACCCACGATGGGCATGGGCGACATCTGAGCAAGCTGCG

Full Affymetrix probeset data:

Annotations for 1625986_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720