FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625989_at:

>probe:Drosophila_2:1625989_at:48:353; Interrogation_Position=1084; Antisense; GCAGCACACTTGTTCGCAAGCAAAT
>probe:Drosophila_2:1625989_at:35:361; Interrogation_Position=1099; Antisense; GCAAGCAAATCCATGTTGGCCCACA
>probe:Drosophila_2:1625989_at:310:465; Interrogation_Position=1113; Antisense; GTTGGCCCACACAAAAGTGCTTTAT
>probe:Drosophila_2:1625989_at:448:699; Interrogation_Position=1137; Antisense; TTTATACCGCTAGCATTGTGTACAT
>probe:Drosophila_2:1625989_at:231:111; Interrogation_Position=1192; Antisense; AGCAATAAGTTGTCCTGATCGGCGG
>probe:Drosophila_2:1625989_at:74:71; Interrogation_Position=1219; Antisense; AGGCTCGAGCTGTATCCTCAGATTC
>probe:Drosophila_2:1625989_at:220:305; Interrogation_Position=1254; Antisense; CCGGCGGCCTTTAGATTTAGTTGTG
>probe:Drosophila_2:1625989_at:457:465; Interrogation_Position=1285; Antisense; GTTGTTGCAGGAATCCATGGCCTAG
>probe:Drosophila_2:1625989_at:258:65; Interrogation_Position=1339; Antisense; ATGGGCATGTGCGACAACTGATTTT
>probe:Drosophila_2:1625989_at:314:705; Interrogation_Position=1366; Antisense; TTATGATTGTCCTAATGCTTTGTAC
>probe:Drosophila_2:1625989_at:205:647; Interrogation_Position=1494; Antisense; TCAGTTGACGAGATACCCCTTATAT
>probe:Drosophila_2:1625989_at:531:65; Interrogation_Position=1528; Antisense; ATGGAGCAGCCAGCACACTGGTTAC
>probe:Drosophila_2:1625989_at:530:539; Interrogation_Position=1547; Antisense; GGTTACCATAGTCGTGTGCTCCATG
>probe:Drosophila_2:1625989_at:133:579; Interrogation_Position=1576; Antisense; GGCCTCCTGTGTCCAAGTGTATTTT

Paste this into a BLAST search page for me
GCAGCACACTTGTTCGCAAGCAAATGCAAGCAAATCCATGTTGGCCCACAGTTGGCCCACACAAAAGTGCTTTATTTTATACCGCTAGCATTGTGTACATAGCAATAAGTTGTCCTGATCGGCGGAGGCTCGAGCTGTATCCTCAGATTCCCGGCGGCCTTTAGATTTAGTTGTGGTTGTTGCAGGAATCCATGGCCTAGATGGGCATGTGCGACAACTGATTTTTTATGATTGTCCTAATGCTTTGTACTCAGTTGACGAGATACCCCTTATATATGGAGCAGCCAGCACACTGGTTACGGTTACCATAGTCGTGTGCTCCATGGGCCTCCTGTGTCCAAGTGTATTTT

Full Affymetrix probeset data:

Annotations for 1625989_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720