Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625990_at:

>probe:Drosophila_2:1625990_at:459:223; Interrogation_Position=1216; Antisense; AAGGTCCATGCATGAAGTGCTCAGT
>probe:Drosophila_2:1625990_at:404:531; Interrogation_Position=1262; Antisense; GGGTATATCAGCTTCCTGTTTGAGG
>probe:Drosophila_2:1625990_at:256:723; Interrogation_Position=1281; Antisense; TTGAGGTAATTTGCGGCGTGGCCTT
>probe:Drosophila_2:1625990_at:199:581; Interrogation_Position=1299; Antisense; TGGCCTTGATGTTCTGGGTATTGCA
>probe:Drosophila_2:1625990_at:553:595; Interrogation_Position=1341; Antisense; TGTCTGAGACGTTGCTGAGCGCTGA
>probe:Drosophila_2:1625990_at:129:361; Interrogation_Position=1380; Antisense; GCAAGCATCCCGACGTACAAGTTTA
>probe:Drosophila_2:1625990_at:76:377; Interrogation_Position=1473; Antisense; GAAGACTGCGTTTTTGCATTACCTA
>probe:Drosophila_2:1625990_at:665:331; Interrogation_Position=1572; Antisense; GCTAGCCTTAGCAGATACGGATTCA
>probe:Drosophila_2:1625990_at:65:713; Interrogation_Position=1593; Antisense; TTCAAATCACACTCGTTCCCTAAAA
>probe:Drosophila_2:1625990_at:330:435; Interrogation_Position=1624; Antisense; GAGGGTGTGTCATGCTTCACATCAC
>probe:Drosophila_2:1625990_at:261:343; Interrogation_Position=1637; Antisense; GCTTCACATCACACATTACTTCTAA
>probe:Drosophila_2:1625990_at:573:217; Interrogation_Position=1689; Antisense; AAGTCAAAGCCTCGCTCAAAGACCG
>probe:Drosophila_2:1625990_at:488:171; Interrogation_Position=1706; Antisense; AAAGACCGCTAGCTCGAAGACTCGA
>probe:Drosophila_2:1625990_at:599:463; Interrogation_Position=1729; Antisense; GATTGTTGGTCATAATGCTGCTCTA

Paste this into a BLAST search page for me
AAGGTCCATGCATGAAGTGCTCAGTGGGTATATCAGCTTCCTGTTTGAGGTTGAGGTAATTTGCGGCGTGGCCTTTGGCCTTGATGTTCTGGGTATTGCATGTCTGAGACGTTGCTGAGCGCTGAGCAAGCATCCCGACGTACAAGTTTAGAAGACTGCGTTTTTGCATTACCTAGCTAGCCTTAGCAGATACGGATTCATTCAAATCACACTCGTTCCCTAAAAGAGGGTGTGTCATGCTTCACATCACGCTTCACATCACACATTACTTCTAAAAGTCAAAGCCTCGCTCAAAGACCGAAAGACCGCTAGCTCGAAGACTCGAGATTGTTGGTCATAATGCTGCTCTA

Full Affymetrix probeset data:

Annotations for 1625990_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime