Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625991_s_at:

>probe:Drosophila_2:1625991_s_at:640:329; Interrogation_Position=303; Antisense; GCGTGAGCTCGTACCGCTACAGCGG
>probe:Drosophila_2:1625991_s_at:569:339; Interrogation_Position=318; Antisense; GCTACAGCGGCATCGTGCACAAGAA
>probe:Drosophila_2:1625991_s_at:690:251; Interrogation_Position=337; Antisense; CAAGAAGACCCTGGGAGTCGTGCCA
>probe:Drosophila_2:1625991_s_at:430:431; Interrogation_Position=351; Antisense; GAGTCGTGCCAGCTGCCGACAAGAA
>probe:Drosophila_2:1625991_s_at:377:157; Interrogation_Position=429; Antisense; ACACCGTGCGTGTTGACTTCAAGGC
>probe:Drosophila_2:1625991_s_at:463:299; Interrogation_Position=459; Antisense; CCCGCCGTTCCCTGAAGAAGCTGAA
>probe:Drosophila_2:1625991_s_at:678:613; Interrogation_Position=480; Antisense; TGAAGAACCTGCTTATCGGCTCCAA
>probe:Drosophila_2:1625991_s_at:117:705; Interrogation_Position=492; Antisense; TTATCGGCTCCAAGTACCGCAAGGA
>probe:Drosophila_2:1625991_s_at:609:217; Interrogation_Position=503; Antisense; AAGTACCGCAAGGACCTGACACAGG
>probe:Drosophila_2:1625991_s_at:558:379; Interrogation_Position=613; Antisense; GAAGCCCGAATAAACTGTACCAGAT
>probe:Drosophila_2:1625991_s_at:506:51; Interrogation_Position=645; Antisense; ATGCGGAGCTGTTTTCTACTCGAGA
>probe:Drosophila_2:1625991_s_at:222:155; Interrogation_Position=706; Antisense; ACAGTTCTGTGGTTATTTGTCGATA
>probe:Drosophila_2:1625991_s_at:665:529; Interrogation_Position=733; Antisense; GGGTAGCGACCAAGTACTGCATACT
>probe:Drosophila_2:1625991_s_at:240:453; Interrogation_Position=866; Antisense; GATCAATCAATCTTTGTTTGCCTAA

Paste this into a BLAST search page for me
GCGTGAGCTCGTACCGCTACAGCGGGCTACAGCGGCATCGTGCACAAGAACAAGAAGACCCTGGGAGTCGTGCCAGAGTCGTGCCAGCTGCCGACAAGAAACACCGTGCGTGTTGACTTCAAGGCCCCGCCGTTCCCTGAAGAAGCTGAATGAAGAACCTGCTTATCGGCTCCAATTATCGGCTCCAAGTACCGCAAGGAAAGTACCGCAAGGACCTGACACAGGGAAGCCCGAATAAACTGTACCAGATATGCGGAGCTGTTTTCTACTCGAGAACAGTTCTGTGGTTATTTGTCGATAGGGTAGCGACCAAGTACTGCATACTGATCAATCAATCTTTGTTTGCCTAA

Full Affymetrix probeset data:

Annotations for 1625991_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime