Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625994_a_at:

>probe:Drosophila_2:1625994_a_at:444:717; Interrogation_Position=111; Antisense; TTCGGAGTATTACTATGCCCGCTGT
>probe:Drosophila_2:1625994_a_at:502:597; Interrogation_Position=133; Antisense; TGTGCCGCTCCAGACTTCTAGGATA
>probe:Drosophila_2:1625994_a_at:499:679; Interrogation_Position=151; Antisense; TAGGATACACACGAGCGCTTGCTGG
>probe:Drosophila_2:1625994_a_at:41:167; Interrogation_Position=198; Antisense; AAATGCTGGCATCTTTACCGGCCAA
>probe:Drosophila_2:1625994_a_at:430:255; Interrogation_Position=309; Antisense; CAACACAATTATTTCCGTCACGGAT
>probe:Drosophila_2:1625994_a_at:400:305; Interrogation_Position=348; Antisense; CCGGCTGATACGATCCTGTGGAATT
>probe:Drosophila_2:1625994_a_at:233:223; Interrogation_Position=394; Antisense; AAGGGAACCAACATAGCAGCTCAAG
>probe:Drosophila_2:1625994_a_at:422:115; Interrogation_Position=411; Antisense; AGCTCAAGCTACAGCGGTTACCATT
>probe:Drosophila_2:1625994_a_at:655:663; Interrogation_Position=476; Antisense; TAAAGGTTCGTGGTCTTGGCCCTGG
>probe:Drosophila_2:1625994_a_at:609:367; Interrogation_Position=503; Antisense; GAATGTCGGCCATCAAAGGACTGCA
>probe:Drosophila_2:1625994_a_at:163:533; Interrogation_Position=532; Antisense; GGTGGGCTGAACATCGTTTCCATTA
>probe:Drosophila_2:1625994_a_at:21:481; Interrogation_Position=547; Antisense; GTTTCCATTACCGACAACACACATG
>probe:Drosophila_2:1625994_a_at:270:153; Interrogation_Position=567; Antisense; ACATGTTTCCTTCAATCCTCCAAGA
>probe:Drosophila_2:1625994_a_at:415:515; Interrogation_Position=93; Antisense; GTGTATTTCTAAGTGCTCTTCGGAG

Paste this into a BLAST search page for me
TTCGGAGTATTACTATGCCCGCTGTTGTGCCGCTCCAGACTTCTAGGATATAGGATACACACGAGCGCTTGCTGGAAATGCTGGCATCTTTACCGGCCAACAACACAATTATTTCCGTCACGGATCCGGCTGATACGATCCTGTGGAATTAAGGGAACCAACATAGCAGCTCAAGAGCTCAAGCTACAGCGGTTACCATTTAAAGGTTCGTGGTCTTGGCCCTGGGAATGTCGGCCATCAAAGGACTGCAGGTGGGCTGAACATCGTTTCCATTAGTTTCCATTACCGACAACACACATGACATGTTTCCTTCAATCCTCCAAGAGTGTATTTCTAAGTGCTCTTCGGAG

Full Affymetrix probeset data:

Annotations for 1625994_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime