Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625996_s_at:

>probe:Drosophila_2:1625996_s_at:515:309; Interrogation_Position=104; Antisense; CCAGACTGGCACACTTGCACATATA
>probe:Drosophila_2:1625996_s_at:645:555; Interrogation_Position=135; Antisense; GGACCCAACCGAATTTTGCTTGTCA
>probe:Drosophila_2:1625996_s_at:115:695; Interrogation_Position=149; Antisense; TTTGCTTGTCAGTTAATGCCCATCA
>probe:Drosophila_2:1625996_s_at:433:33; Interrogation_Position=170; Antisense; ATCAATCGAATCAATCCCAGCACAG
>probe:Drosophila_2:1625996_s_at:239:113; Interrogation_Position=188; Antisense; AGCACAGCCATGAGAAGCGCGTCGC
>probe:Drosophila_2:1625996_s_at:236:671; Interrogation_Position=20; Antisense; TACGAACTCAGGACGCTCTTCTTTG
>probe:Drosophila_2:1625996_s_at:52:125; Interrogation_Position=203; Antisense; AGCGCGTCGCTTAAGTTCTATCTGA
>probe:Drosophila_2:1625996_s_at:290:25; Interrogation_Position=227; Antisense; ATATGTCTGCTAGTTATCTGCGTGA
>probe:Drosophila_2:1625996_s_at:59:431; Interrogation_Position=274; Antisense; GAGTCCGCAACTTTCACGTAAGGAA
>probe:Drosophila_2:1625996_s_at:476:19; Interrogation_Position=363; Antisense; ATAGTGCCTACGATCGGAATACCCG
>probe:Drosophila_2:1625996_s_at:588:361; Interrogation_Position=379; Antisense; GAATACCCGAAGACCTTGAAGTGCA
>probe:Drosophila_2:1625996_s_at:3:551; Interrogation_Position=457; Antisense; GGAGTGCCACTTTTTATGTCGTATT
>probe:Drosophila_2:1625996_s_at:163:211; Interrogation_Position=65; Antisense; AAGACTTGGCTAATCGCCGACGACA
>probe:Drosophila_2:1625996_s_at:554:401; Interrogation_Position=86; Antisense; GACATACGTTGAAGAGCTCCAGACT

Paste this into a BLAST search page for me
CCAGACTGGCACACTTGCACATATAGGACCCAACCGAATTTTGCTTGTCATTTGCTTGTCAGTTAATGCCCATCAATCAATCGAATCAATCCCAGCACAGAGCACAGCCATGAGAAGCGCGTCGCTACGAACTCAGGACGCTCTTCTTTGAGCGCGTCGCTTAAGTTCTATCTGAATATGTCTGCTAGTTATCTGCGTGAGAGTCCGCAACTTTCACGTAAGGAAATAGTGCCTACGATCGGAATACCCGGAATACCCGAAGACCTTGAAGTGCAGGAGTGCCACTTTTTATGTCGTATTAAGACTTGGCTAATCGCCGACGACAGACATACGTTGAAGAGCTCCAGACT

Full Affymetrix probeset data:

Annotations for 1625996_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime