Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625999_at:

>probe:Drosophila_2:1625999_at:576:219; Interrogation_Position=2591; Antisense; AAGTGCCGCCAGGAGCTGCAAGCGA
>probe:Drosophila_2:1625999_at:724:379; Interrogation_Position=2617; Antisense; GAACCAGCGAATTGCCGAACTGCTC
>probe:Drosophila_2:1625999_at:112:589; Interrogation_Position=2649; Antisense; TGGAGGAGCAGCACGCCAGCATCGA
>probe:Drosophila_2:1625999_at:290:347; Interrogation_Position=2667; Antisense; GCATCGACTCCGAAAGGCAATCTAT
>probe:Drosophila_2:1625999_at:571:423; Interrogation_Position=2714; Antisense; GAGAAACAGCGCCAGTCAGTCGACC
>probe:Drosophila_2:1625999_at:455:447; Interrogation_Position=2797; Antisense; GATGCGATCCGCACAGCAGCGATAT
>probe:Drosophila_2:1625999_at:329:23; Interrogation_Position=2818; Antisense; ATATCAAAGTGCCAAGCGTACCGCC
>probe:Drosophila_2:1625999_at:441:275; Interrogation_Position=2833; Antisense; GCGTACCGCCCACAATTACAAGTTG
>probe:Drosophila_2:1625999_at:51:431; Interrogation_Position=2912; Antisense; GAGTACGAGCTATCACTCGCCAAGA
>probe:Drosophila_2:1625999_at:432:451; Interrogation_Position=2935; Antisense; GATCGAGGCGACCATGAACCAGCAC
>probe:Drosophila_2:1625999_at:507:423; Interrogation_Position=2996; Antisense; GAGAACGTGCCCAGCAATAGCAGCA
>probe:Drosophila_2:1625999_at:471:529; Interrogation_Position=3116; Antisense; GGGATATCGTTACTGCATGCACTGC
>probe:Drosophila_2:1625999_at:82:349; Interrogation_Position=3130; Antisense; GCATGCACTGCCAAATTGTCTAAAC
>probe:Drosophila_2:1625999_at:541:183; Interrogation_Position=3159; Antisense; AAAAGTCGCTGTACATTCCTAACAA

Paste this into a BLAST search page for me
AAGTGCCGCCAGGAGCTGCAAGCGAGAACCAGCGAATTGCCGAACTGCTCTGGAGGAGCAGCACGCCAGCATCGAGCATCGACTCCGAAAGGCAATCTATGAGAAACAGCGCCAGTCAGTCGACCGATGCGATCCGCACAGCAGCGATATATATCAAAGTGCCAAGCGTACCGCCGCGTACCGCCCACAATTACAAGTTGGAGTACGAGCTATCACTCGCCAAGAGATCGAGGCGACCATGAACCAGCACGAGAACGTGCCCAGCAATAGCAGCAGGGATATCGTTACTGCATGCACTGCGCATGCACTGCCAAATTGTCTAAACAAAAGTCGCTGTACATTCCTAACAA

Full Affymetrix probeset data:

Annotations for 1625999_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime