Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626000_at:

>probe:Drosophila_2:1626000_at:726:461; Interrogation_Position=1012; Antisense; GATTACATCTACAAGGTCCAGGCGG
>probe:Drosophila_2:1626000_at:117:31; Interrogation_Position=1037; Antisense; ATAACAATCAAACCCTGTGCCTATC
>probe:Drosophila_2:1626000_at:101:47; Interrogation_Position=1059; Antisense; ATCCGGCTTCACATACTTGCAGGGT
>probe:Drosophila_2:1626000_at:515:529; Interrogation_Position=1193; Antisense; GGGTTTATGCCTCCAGTTATGTGAA
>probe:Drosophila_2:1626000_at:42:109; Interrogation_Position=1218; Antisense; AGAACCATCTAGCTACGGCATCGAT
>probe:Drosophila_2:1626000_at:578:293; Interrogation_Position=1239; Antisense; CGATTACCCATTCTACGGCGATGAA
>probe:Drosophila_2:1626000_at:506:531; Interrogation_Position=703; Antisense; GGTGGAATCGATCGGAGCATCTACA
>probe:Drosophila_2:1626000_at:493:541; Interrogation_Position=730; Antisense; GGTTGCATCAACTACGTTCCAGTAT
>probe:Drosophila_2:1626000_at:181:483; Interrogation_Position=751; Antisense; GTATCGATGCCTGCCTATTGGCAAT
>probe:Drosophila_2:1626000_at:55:533; Interrogation_Position=789; Antisense; GGTGAAAATCGAGGGCATCCTTCTC
>probe:Drosophila_2:1626000_at:494:469; Interrogation_Position=862; Antisense; GTTCCCCTGCGAGCCTATAAAGCGA
>probe:Drosophila_2:1626000_at:6:515; Interrogation_Position=895; Antisense; GTGTTGAATGCCACTGATGCCGGAG
>probe:Drosophila_2:1626000_at:643:351; Interrogation_Position=941; Antisense; GCAGCAGTCTCTGTAGATTGCCGAA
>probe:Drosophila_2:1626000_at:587:161; Interrogation_Position=975; Antisense; AAATATCGGTGGCACTACCTACACA

Paste this into a BLAST search page for me
GATTACATCTACAAGGTCCAGGCGGATAACAATCAAACCCTGTGCCTATCATCCGGCTTCACATACTTGCAGGGTGGGTTTATGCCTCCAGTTATGTGAAAGAACCATCTAGCTACGGCATCGATCGATTACCCATTCTACGGCGATGAAGGTGGAATCGATCGGAGCATCTACAGGTTGCATCAACTACGTTCCAGTATGTATCGATGCCTGCCTATTGGCAATGGTGAAAATCGAGGGCATCCTTCTCGTTCCCCTGCGAGCCTATAAAGCGAGTGTTGAATGCCACTGATGCCGGAGGCAGCAGTCTCTGTAGATTGCCGAAAAATATCGGTGGCACTACCTACACA

Full Affymetrix probeset data:

Annotations for 1626000_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime