FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626002_at:

>probe:Drosophila_2:1626002_at:590:575; Interrogation_Position=1007; Antisense; TGGCCATCGAGTGTTCCACTTTAAG
>probe:Drosophila_2:1626002_at:591:471; Interrogation_Position=564; Antisense; GTTCAAGCGACACGGACTGGAGCCA
>probe:Drosophila_2:1626002_at:143:545; Interrogation_Position=591; Antisense; GGATCCCATCAACCAGAAGTTCGAC
>probe:Drosophila_2:1626002_at:51:375; Interrogation_Position=606; Antisense; GAAGTTCGACCCCAATCAGCACGAG
>probe:Drosophila_2:1626002_at:613:75; Interrogation_Position=644; Antisense; AGGAGGACAAGACCGTCGAGCCCAA
>probe:Drosophila_2:1626002_at:569:249; Interrogation_Position=687; Antisense; CAAGCTGGGCTACAAACTGCACGAG
>probe:Drosophila_2:1626002_at:48:637; Interrogation_Position=742; Antisense; TCGAAGTGTTGATAGCCATGCGGCT
>probe:Drosophila_2:1626002_at:357:51; Interrogation_Position=759; Antisense; ATGCGGCTGCCCAGAGGCATGTAAA
>probe:Drosophila_2:1626002_at:627:329; Interrogation_Position=825; Antisense; GCGTGTGTCTCTCAATTGTTTGCAA
>probe:Drosophila_2:1626002_at:50:617; Interrogation_Position=845; Antisense; TGCAATTTGTTTTCCGCTGCAAAAT
>probe:Drosophila_2:1626002_at:653:161; Interrogation_Position=866; Antisense; AAATTCATGTACGTAAACCCTGTGT
>probe:Drosophila_2:1626002_at:431:491; Interrogation_Position=889; Antisense; GTAAATACAACCTATCCCACAAACG
>probe:Drosophila_2:1626002_at:585:269; Interrogation_Position=914; Antisense; CATCCTTCGGGCAAAGCTTGCGAAT
>probe:Drosophila_2:1626002_at:304:249; Interrogation_Position=989; Antisense; CAATTTGTACCATACGCGTGGCCAT

Paste this into a BLAST search page for me
TGGCCATCGAGTGTTCCACTTTAAGGTTCAAGCGACACGGACTGGAGCCAGGATCCCATCAACCAGAAGTTCGACGAAGTTCGACCCCAATCAGCACGAGAGGAGGACAAGACCGTCGAGCCCAACAAGCTGGGCTACAAACTGCACGAGTCGAAGTGTTGATAGCCATGCGGCTATGCGGCTGCCCAGAGGCATGTAAAGCGTGTGTCTCTCAATTGTTTGCAATGCAATTTGTTTTCCGCTGCAAAATAAATTCATGTACGTAAACCCTGTGTGTAAATACAACCTATCCCACAAACGCATCCTTCGGGCAAAGCTTGCGAATCAATTTGTACCATACGCGTGGCCAT

Full Affymetrix probeset data:

Annotations for 1626002_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720