FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626005_at:

>probe:Drosophila_2:1626005_at:297:365; Interrogation_Position=1125; Antisense; GAATACTTTAGTCTGGCATGCGATC
>probe:Drosophila_2:1626005_at:722:347; Interrogation_Position=1140; Antisense; GCATGCGATCATTTTTTCTTTTGTT
>probe:Drosophila_2:1626005_at:648:543; Interrogation_Position=1186; Antisense; GGATCATATTATTTCTGTCACGTAA
>probe:Drosophila_2:1626005_at:314:339; Interrogation_Position=1225; Antisense; GCTAATACTATTCTTGCTTCCAGGT
>probe:Drosophila_2:1626005_at:86:715; Interrogation_Position=677; Antisense; TTGAAAACCCTACGCACGATTTTTG
>probe:Drosophila_2:1626005_at:310:699; Interrogation_Position=756; Antisense; TTTTTGGATCACTCTTGCTATTGTA
>probe:Drosophila_2:1626005_at:630:337; Interrogation_Position=772; Antisense; GCTATTGTATTTCTCGGTGGCGTTT
>probe:Drosophila_2:1626005_at:90:575; Interrogation_Position=790; Antisense; GGCGTTTGTAGCACGGACATTCTTT
>probe:Drosophila_2:1626005_at:540:557; Interrogation_Position=804; Antisense; GGACATTCTTTCTTTGGGCTACATT
>probe:Drosophila_2:1626005_at:345:525; Interrogation_Position=819; Antisense; GGGCTACATTATATTTGCTTTGATC
>probe:Drosophila_2:1626005_at:69:451; Interrogation_Position=840; Antisense; GATCTTTTTATTGCAGGGCTCCGAG
>probe:Drosophila_2:1626005_at:481:523; Interrogation_Position=855; Antisense; GGGCTCCGAGATATACCTGCAAAAT
>probe:Drosophila_2:1626005_at:664:647; Interrogation_Position=882; Antisense; TCACTTTATTATTTGCCGTTGGAAC
>probe:Drosophila_2:1626005_at:287:293; Interrogation_Position=898; Antisense; CGTTGGAACTGTCTGATTGCTTTTA

Paste this into a BLAST search page for me
GAATACTTTAGTCTGGCATGCGATCGCATGCGATCATTTTTTCTTTTGTTGGATCATATTATTTCTGTCACGTAAGCTAATACTATTCTTGCTTCCAGGTTTGAAAACCCTACGCACGATTTTTGTTTTTGGATCACTCTTGCTATTGTAGCTATTGTATTTCTCGGTGGCGTTTGGCGTTTGTAGCACGGACATTCTTTGGACATTCTTTCTTTGGGCTACATTGGGCTACATTATATTTGCTTTGATCGATCTTTTTATTGCAGGGCTCCGAGGGGCTCCGAGATATACCTGCAAAATTCACTTTATTATTTGCCGTTGGAACCGTTGGAACTGTCTGATTGCTTTTA

Full Affymetrix probeset data:

Annotations for 1626005_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720