FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626006_at:

>probe:Drosophila_2:1626006_at:470:97; Interrogation_Position=1008; Antisense; AGATCTTCTCCACCGAGTTCAAGGA
>probe:Drosophila_2:1626006_at:475:711; Interrogation_Position=1025; Antisense; TTCAAGGACTTCGTGGACATCTGCC
>probe:Drosophila_2:1626006_at:366:39; Interrogation_Position=1043; Antisense; ATCTGCCTGAAGAAACAGCCCGACG
>probe:Drosophila_2:1626006_at:322:137; Interrogation_Position=1065; Antisense; ACGAGCGGGCAGATCTCAAGACCCT
>probe:Drosophila_2:1626006_at:436:213; Interrogation_Position=1082; Antisense; AAGACCCTGCTGAGTCATCCGTGGA
>probe:Drosophila_2:1626006_at:106:23; Interrogation_Position=1134; Antisense; ATATATCCGGCTGGGTGTGCAAGAC
>probe:Drosophila_2:1626006_at:45:205; Interrogation_Position=1184; Antisense; AAGCGTAATACGTCGCCCAACTAGA
>probe:Drosophila_2:1626006_at:589:23; Interrogation_Position=1247; Antisense; ATATCCACACTTGCTCTTTGTTCAA
>probe:Drosophila_2:1626006_at:666:407; Interrogation_Position=1274; Antisense; GAGCGTTGACGCTGGGCAAAAACAA
>probe:Drosophila_2:1626006_at:183:289; Interrogation_Position=768; Antisense; CGGAGCGATTGCAGGGCACCCACTA
>probe:Drosophila_2:1626006_at:15:271; Interrogation_Position=808; Antisense; CATCTGGTCGTTGGGTCTGTCGCTG
>probe:Drosophila_2:1626006_at:531:547; Interrogation_Position=835; Antisense; GGAGATGGCCATCGGCATGTACCCC
>probe:Drosophila_2:1626006_at:64:305; Interrogation_Position=883; Antisense; CCTGGAGTCGATATTCGCCGACAAT
>probe:Drosophila_2:1626006_at:199:315; Interrogation_Position=950; Antisense; GCCATCTTCGAGCTGCTGGATTATA

Paste this into a BLAST search page for me
AGATCTTCTCCACCGAGTTCAAGGATTCAAGGACTTCGTGGACATCTGCCATCTGCCTGAAGAAACAGCCCGACGACGAGCGGGCAGATCTCAAGACCCTAAGACCCTGCTGAGTCATCCGTGGAATATATCCGGCTGGGTGTGCAAGACAAGCGTAATACGTCGCCCAACTAGAATATCCACACTTGCTCTTTGTTCAAGAGCGTTGACGCTGGGCAAAAACAACGGAGCGATTGCAGGGCACCCACTACATCTGGTCGTTGGGTCTGTCGCTGGGAGATGGCCATCGGCATGTACCCCCCTGGAGTCGATATTCGCCGACAATGCCATCTTCGAGCTGCTGGATTATA

Full Affymetrix probeset data:

Annotations for 1626006_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720