Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626007_at:

>probe:Drosophila_2:1626007_at:422:469; Interrogation_Position=1008; Antisense; GTTCCTATCGGACCGTCAAGTTCTC
>probe:Drosophila_2:1626007_at:485:245; Interrogation_Position=1041; Antisense; AATTGCTCGAGCTGCCGGTGGTTGT
>probe:Drosophila_2:1626007_at:560:433; Interrogation_Position=1073; Antisense; GAGGCGAAGACCTGGTACGGCAAAA
>probe:Drosophila_2:1626007_at:287:361; Interrogation_Position=624; Antisense; GCAAGTGCCTGCAGCGCTATCGCTA
>probe:Drosophila_2:1626007_at:711:511; Interrogation_Position=675; Antisense; GTGAGCTCTTCAAGATGGGTCGCCA
>probe:Drosophila_2:1626007_at:169:589; Interrogation_Position=690; Antisense; TGGGTCGCCACCTGAAGGAGGCCTA
>probe:Drosophila_2:1626007_at:577:109; Interrogation_Position=717; Antisense; AGAAGATACTCGAGCGCACGCAGTC
>probe:Drosophila_2:1626007_at:611:259; Interrogation_Position=733; Antisense; CACGCAGTCTCGCTTGGAGTATGCA
>probe:Drosophila_2:1626007_at:169:97; Interrogation_Position=759; Antisense; AGATCAAGCGGCAGGCACTCGACGA
>probe:Drosophila_2:1626007_at:473:145; Interrogation_Position=775; Antisense; ACTCGACGAGATGACGGTGGCCCAC
>probe:Drosophila_2:1626007_at:91:63; Interrogation_Position=803; Antisense; ATGTGCCTGGGCTCAACGCGAAGTC
>probe:Drosophila_2:1626007_at:453:227; Interrogation_Position=880; Antisense; AAGGCCATCGGTTATGTCCCGCAAA
>probe:Drosophila_2:1626007_at:714:183; Interrogation_Position=902; Antisense; AAAATCGGTAGCCTCGGCACGTCTG
>probe:Drosophila_2:1626007_at:52:51; Interrogation_Position=936; Antisense; ATGCCGATAGCAATCGCGCCGAGGA

Paste this into a BLAST search page for me
GTTCCTATCGGACCGTCAAGTTCTCAATTGCTCGAGCTGCCGGTGGTTGTGAGGCGAAGACCTGGTACGGCAAAAGCAAGTGCCTGCAGCGCTATCGCTAGTGAGCTCTTCAAGATGGGTCGCCATGGGTCGCCACCTGAAGGAGGCCTAAGAAGATACTCGAGCGCACGCAGTCCACGCAGTCTCGCTTGGAGTATGCAAGATCAAGCGGCAGGCACTCGACGAACTCGACGAGATGACGGTGGCCCACATGTGCCTGGGCTCAACGCGAAGTCAAGGCCATCGGTTATGTCCCGCAAAAAAATCGGTAGCCTCGGCACGTCTGATGCCGATAGCAATCGCGCCGAGGA

Full Affymetrix probeset data:

Annotations for 1626007_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime