FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626010_at:

>probe:Drosophila_2:1626010_at:500:475; Interrogation_Position=167; Antisense; GTATTTTGTTTTGCGCTTTCTACCT
>probe:Drosophila_2:1626010_at:257:535; Interrogation_Position=203; Antisense; GGTGCGCTCAGCTATTGTGCAACAT
>probe:Drosophila_2:1626010_at:408:699; Interrogation_Position=236; Antisense; TTCTTTACCCTGCTTACATTTCCAT
>probe:Drosophila_2:1626010_at:487:593; Interrogation_Position=313; Antisense; TGGGTCACTTTTGGCATCTTCACTG
>probe:Drosophila_2:1626010_at:192:465; Interrogation_Position=339; Antisense; GATTGAATTCTATCCAAGTCTGCTA
>probe:Drosophila_2:1626010_at:709:57; Interrogation_Position=370; Antisense; ATGATTCCCTTCTACTGGCTGTTGA
>probe:Drosophila_2:1626010_at:247:559; Interrogation_Position=434; Antisense; GGAATGGTTCTACCCTTATCTACCA
>probe:Drosophila_2:1626010_at:441:591; Interrogation_Position=464; Antisense; TGGTCCGACCATACTTCCTGAAGCT
>probe:Drosophila_2:1626010_at:278:711; Interrogation_Position=488; Antisense; TTCACGATCCCGTCGACATGATGTC
>probe:Drosophila_2:1626010_at:448:153; Interrogation_Position=503; Antisense; ACATGATGTCCGCTGGAGTGCCAAA
>probe:Drosophila_2:1626010_at:331:19; Interrogation_Position=545; Antisense; ATTTGCGTTAACTCCATGCATTTGG
>probe:Drosophila_2:1626010_at:96:53; Interrogation_Position=560; Antisense; ATGCATTTGGTTTACGGTCTGCAAA
>probe:Drosophila_2:1626010_at:348:203; Interrogation_Position=587; Antisense; AACCTCACCTCGTATCGGATACATT
>probe:Drosophila_2:1626010_at:535:113; Interrogation_Position=655; Antisense; AGCACCAGTGGTCGCTGAATCCTAA

Paste this into a BLAST search page for me
GTATTTTGTTTTGCGCTTTCTACCTGGTGCGCTCAGCTATTGTGCAACATTTCTTTACCCTGCTTACATTTCCATTGGGTCACTTTTGGCATCTTCACTGGATTGAATTCTATCCAAGTCTGCTAATGATTCCCTTCTACTGGCTGTTGAGGAATGGTTCTACCCTTATCTACCATGGTCCGACCATACTTCCTGAAGCTTTCACGATCCCGTCGACATGATGTCACATGATGTCCGCTGGAGTGCCAAAATTTGCGTTAACTCCATGCATTTGGATGCATTTGGTTTACGGTCTGCAAAAACCTCACCTCGTATCGGATACATTAGCACCAGTGGTCGCTGAATCCTAA

Full Affymetrix probeset data:

Annotations for 1626010_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720