FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626011_at:

>probe:Drosophila_2:1626011_at:644:513; Interrogation_Position=1042; Antisense; GTGTTGCTACACAATATTCGATAGA
>probe:Drosophila_2:1626011_at:107:27; Interrogation_Position=1062; Antisense; ATAGAGACAGCAATGCCAGTGCGAC
>probe:Drosophila_2:1626011_at:690:505; Interrogation_Position=1080; Antisense; GTGCGACTGGCATTTAGTATTATCT
>probe:Drosophila_2:1626011_at:291:89; Interrogation_Position=1153; Antisense; AGTCTTAATTGTTGGACCTTGTAAT
>probe:Drosophila_2:1626011_at:98:413; Interrogation_Position=1167; Antisense; GACCTTGTAATTGTTTAGTCCTAAG
>probe:Drosophila_2:1626011_at:676:137; Interrogation_Position=754; Antisense; ACGTCTGGAAGGTAATGATGGCCCC
>probe:Drosophila_2:1626011_at:267:607; Interrogation_Position=769; Antisense; TGATGGCCCCAGTGGTGCACACACC
>probe:Drosophila_2:1626011_at:609:299; Interrogation_Position=793; Antisense; CCCACTTTTGGGTGGTGCTGCTAAT
>probe:Drosophila_2:1626011_at:330:173; Interrogation_Position=822; Antisense; AAAGCAGCGGCAAGAGCACCCGCAG
>probe:Drosophila_2:1626011_at:45:115; Interrogation_Position=848; Antisense; AGCAGCATCGTATCCAGCGGTGTGC
>probe:Drosophila_2:1626011_at:357:597; Interrogation_Position=868; Antisense; TGTGCCCAAGGTCAAGTTCTATCTG
>probe:Drosophila_2:1626011_at:495:531; Interrogation_Position=924; Antisense; GGGTACTAGCAGTATTTGTGCCAAA
>probe:Drosophila_2:1626011_at:624:5; Interrogation_Position=950; Antisense; ATTGAGGAACTCTCGCAATGCGGAT
>probe:Drosophila_2:1626011_at:418:551; Interrogation_Position=985; Antisense; GGAGAGTGACCAATATCGCCAAAAT

Paste this into a BLAST search page for me
GTGTTGCTACACAATATTCGATAGAATAGAGACAGCAATGCCAGTGCGACGTGCGACTGGCATTTAGTATTATCTAGTCTTAATTGTTGGACCTTGTAATGACCTTGTAATTGTTTAGTCCTAAGACGTCTGGAAGGTAATGATGGCCCCTGATGGCCCCAGTGGTGCACACACCCCCACTTTTGGGTGGTGCTGCTAATAAAGCAGCGGCAAGAGCACCCGCAGAGCAGCATCGTATCCAGCGGTGTGCTGTGCCCAAGGTCAAGTTCTATCTGGGGTACTAGCAGTATTTGTGCCAAAATTGAGGAACTCTCGCAATGCGGATGGAGAGTGACCAATATCGCCAAAAT

Full Affymetrix probeset data:

Annotations for 1626011_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720