FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626012_at:

>probe:Drosophila_2:1626012_at:496:263; Interrogation_Position=406; Antisense; CAGCATTTGTACGTGGCCCAGGCGA
>probe:Drosophila_2:1626012_at:420:657; Interrogation_Position=455; Antisense; TAAGGAAGGCTCAGTCGGTGGCCTC
>probe:Drosophila_2:1626012_at:297:77; Interrogation_Position=500; Antisense; AGGAGTCGGCCAACCATGTGCGCAG
>probe:Drosophila_2:1626012_at:120:583; Interrogation_Position=602; Antisense; TGGCGGCCCATGATCAGCTGCTGTT
>probe:Drosophila_2:1626012_at:656:441; Interrogation_Position=640; Antisense; GATGTGGACGCGCTGTCCTCGCAAA
>probe:Drosophila_2:1626012_at:467:503; Interrogation_Position=654; Antisense; GTCCTCGCAAATGGTGGGTCTCCAG
>probe:Drosophila_2:1626012_at:150:435; Interrogation_Position=685; Antisense; GAGGGCATTGTCCAGCCGAAACTCA
>probe:Drosophila_2:1626012_at:670:543; Interrogation_Position=714; Antisense; GGATCTCCATGCTCTTTTGGACAAG
>probe:Drosophila_2:1626012_at:488:377; Interrogation_Position=741; Antisense; GAAGCAGCCACTCCAGAATTATGAT
>probe:Drosophila_2:1626012_at:710:497; Interrogation_Position=797; Antisense; GTCTGCCGGGAACATTAAGCCATCA
>probe:Drosophila_2:1626012_at:169:79; Interrogation_Position=864; Antisense; AGGTCAAGGGCCGATCCAAGGACAG
>probe:Drosophila_2:1626012_at:413:555; Interrogation_Position=913; Antisense; GGACCTGCGAATCCCTCAAATGGAC
>probe:Drosophila_2:1626012_at:706:17; Interrogation_Position=950; Antisense; ATTTCATTAGCTTGCCTAGGGCTCA
>probe:Drosophila_2:1626012_at:396:83; Interrogation_Position=967; Antisense; AGGGCTCATCACTATGCCAACATGG

Paste this into a BLAST search page for me
CAGCATTTGTACGTGGCCCAGGCGATAAGGAAGGCTCAGTCGGTGGCCTCAGGAGTCGGCCAACCATGTGCGCAGTGGCGGCCCATGATCAGCTGCTGTTGATGTGGACGCGCTGTCCTCGCAAAGTCCTCGCAAATGGTGGGTCTCCAGGAGGGCATTGTCCAGCCGAAACTCAGGATCTCCATGCTCTTTTGGACAAGGAAGCAGCCACTCCAGAATTATGATGTCTGCCGGGAACATTAAGCCATCAAGGTCAAGGGCCGATCCAAGGACAGGGACCTGCGAATCCCTCAAATGGACATTTCATTAGCTTGCCTAGGGCTCAAGGGCTCATCACTATGCCAACATGG

Full Affymetrix probeset data:

Annotations for 1626012_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720