FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626013_at:

>probe:Drosophila_2:1626013_at:171:63; Interrogation_Position=260; Antisense; ATGTGCTCAGCCTGCGGCGAGTCAT
>probe:Drosophila_2:1626013_at:542:139; Interrogation_Position=290; Antisense; ACGGCGATTATAATCCCCAGAGCCA
>probe:Drosophila_2:1626013_at:304:413; Interrogation_Position=322; Antisense; GACCTGGCGTTGCTCATCTTGAATG
>probe:Drosophila_2:1626013_at:703:369; Interrogation_Position=342; Antisense; GAATGGCCAGCTCAATTTCACCGAG
>probe:Drosophila_2:1626013_at:542:93; Interrogation_Position=477; Antisense; AGTTGGAGTGTCTCCGCAACTTCGT
>probe:Drosophila_2:1626013_at:723:357; Interrogation_Position=492; Antisense; GCAACTTCGTTTCGTGGACGTGGAT
>probe:Drosophila_2:1626013_at:251:87; Interrogation_Position=524; Antisense; AGTCGAATCAGTGCCGGCGTGCCTA
>probe:Drosophila_2:1626013_at:292:627; Interrogation_Position=543; Antisense; TGCCTATAGCCAGGTGTTGCCCATA
>probe:Drosophila_2:1626013_at:545:603; Interrogation_Position=557; Antisense; TGTTGCCCATAACCCGGCGGATGAT
>probe:Drosophila_2:1626013_at:205:129; Interrogation_Position=630; Antisense; ACCACTGGTGGGTTACGCAGCGGAA
>probe:Drosophila_2:1626013_at:677:67; Interrogation_Position=667; Antisense; AGGCTATATGGCATCGTTTCCTGGG
>probe:Drosophila_2:1626013_at:502:357; Interrogation_Position=703; Antisense; GCAAATCCCAACTTTCCAGGAGTGT
>probe:Drosophila_2:1626013_at:436:77; Interrogation_Position=720; Antisense; AGGAGTGTACACCAATGTGGCTGCC
>probe:Drosophila_2:1626013_at:202:283; Interrogation_Position=740; Antisense; CTGCCTTCCGCAGCTGGATAGATGA

Paste this into a BLAST search page for me
ATGTGCTCAGCCTGCGGCGAGTCATACGGCGATTATAATCCCCAGAGCCAGACCTGGCGTTGCTCATCTTGAATGGAATGGCCAGCTCAATTTCACCGAGAGTTGGAGTGTCTCCGCAACTTCGTGCAACTTCGTTTCGTGGACGTGGATAGTCGAATCAGTGCCGGCGTGCCTATGCCTATAGCCAGGTGTTGCCCATATGTTGCCCATAACCCGGCGGATGATACCACTGGTGGGTTACGCAGCGGAAAGGCTATATGGCATCGTTTCCTGGGGCAAATCCCAACTTTCCAGGAGTGTAGGAGTGTACACCAATGTGGCTGCCCTGCCTTCCGCAGCTGGATAGATGA

Full Affymetrix probeset data:

Annotations for 1626013_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720