FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626023_at:

>probe:Drosophila_2:1626023_at:53:199; Interrogation_Position=184; Antisense; AACGACTCGGGATCTCAGGAGCGTC
>probe:Drosophila_2:1626023_at:231:311; Interrogation_Position=223; Antisense; GCCAATAATGCGCTATCAGAGTCCA
>probe:Drosophila_2:1626023_at:354:101; Interrogation_Position=240; Antisense; AGAGTCCATTGGAGCTCGCGTTTCC
>probe:Drosophila_2:1626023_at:53:527; Interrogation_Position=276; Antisense; GGGCAACTTGGAACCATTCATCCGT
>probe:Drosophila_2:1626023_at:472:485; Interrogation_Position=299; Antisense; GTAGAATGGCACGTAGCCCTACGCC
>probe:Drosophila_2:1626023_at:124:103; Interrogation_Position=30; Antisense; AGACTGGTCCCCATATGTCACTTAT
>probe:Drosophila_2:1626023_at:185:183; Interrogation_Position=338; Antisense; AAAACGGCTCGGTATCACAAGGTCA
>probe:Drosophila_2:1626023_at:597:481; Interrogation_Position=349; Antisense; GTATCACAAGGTCAGCTGCTGGCCA
>probe:Drosophila_2:1626023_at:623:59; Interrogation_Position=383; Antisense; ATGTCACCGAGTTCTTTCACCGCAT
>probe:Drosophila_2:1626023_at:122:133; Interrogation_Position=401; Antisense; ACCGCATTGCTGTGGGTCTCGTCGA
>probe:Drosophila_2:1626023_at:684:379; Interrogation_Position=441; Antisense; GAAGCCTTTCTTGGCATTGCGCAAA
>probe:Drosophila_2:1626023_at:656:599; Interrogation_Position=45; Antisense; TGTCACTTATGAGGCGGGTACACCA
>probe:Drosophila_2:1626023_at:311:191; Interrogation_Position=464; Antisense; AACATATTGCTCAACTGGTGGGTCA
>probe:Drosophila_2:1626023_at:442:103; Interrogation_Position=70; Antisense; AGACGTCCCCACAGTGCTTTGGAGA

Paste this into a BLAST search page for me
AACGACTCGGGATCTCAGGAGCGTCGCCAATAATGCGCTATCAGAGTCCAAGAGTCCATTGGAGCTCGCGTTTCCGGGCAACTTGGAACCATTCATCCGTGTAGAATGGCACGTAGCCCTACGCCAGACTGGTCCCCATATGTCACTTATAAAACGGCTCGGTATCACAAGGTCAGTATCACAAGGTCAGCTGCTGGCCAATGTCACCGAGTTCTTTCACCGCATACCGCATTGCTGTGGGTCTCGTCGAGAAGCCTTTCTTGGCATTGCGCAAATGTCACTTATGAGGCGGGTACACCAAACATATTGCTCAACTGGTGGGTCAAGACGTCCCCACAGTGCTTTGGAGA

Full Affymetrix probeset data:

Annotations for 1626023_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720