FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626024_at:

>probe:Drosophila_2:1626024_at:96:659; Interrogation_Position=1143; Antisense; TAACGAAGATTCCTCCCTCAAATAA
>probe:Drosophila_2:1626024_at:171:601; Interrogation_Position=595; Antisense; TGTACAACCCATTCCAGTGCCAGTG
>probe:Drosophila_2:1626024_at:6:683; Interrogation_Position=648; Antisense; TATCGCTCTTTGCTCCAGGAATTCT
>probe:Drosophila_2:1626024_at:11:3; Interrogation_Position=664; Antisense; AGGAATTCTTAACTCGGCCGTGGTG
>probe:Drosophila_2:1626024_at:189:593; Interrogation_Position=691; Antisense; TGGTGTTCCAGTCAGAGATCCTCTA
>probe:Drosophila_2:1626024_at:628:47; Interrogation_Position=708; Antisense; ATCCTCTAAGAGATCCAGTTCGTCC
>probe:Drosophila_2:1626024_at:361:373; Interrogation_Position=758; Antisense; GAAGTGGATCCCAACTATGCGGCAC
>probe:Drosophila_2:1626024_at:602:655; Interrogation_Position=792; Antisense; TAAGGCGACCTGTTCCGAATCGTGT
>probe:Drosophila_2:1626024_at:73:517; Interrogation_Position=813; Antisense; GTGTGTACTACGATTCTGCGGGAGC
>probe:Drosophila_2:1626024_at:681:281; Interrogation_Position=828; Antisense; CTGCGGGAGCGGTAAGTTCATTAAC
>probe:Drosophila_2:1626024_at:212:239; Interrogation_Position=891; Antisense; AATAACTTTTTTCATGCCAGCCTCC
>probe:Drosophila_2:1626024_at:226:597; Interrogation_Position=916; Antisense; TGTGACACCTGCTCAACTAGTTGGA
>probe:Drosophila_2:1626024_at:580:329; Interrogation_Position=942; Antisense; GCGTGGCCACCACAGTAAACGGAAT
>probe:Drosophila_2:1626024_at:167:161; Interrogation_Position=985; Antisense; ACAAGTGCAGCCAGTTTACCAAACG

Paste this into a BLAST search page for me
TAACGAAGATTCCTCCCTCAAATAATGTACAACCCATTCCAGTGCCAGTGTATCGCTCTTTGCTCCAGGAATTCTAGGAATTCTTAACTCGGCCGTGGTGTGGTGTTCCAGTCAGAGATCCTCTAATCCTCTAAGAGATCCAGTTCGTCCGAAGTGGATCCCAACTATGCGGCACTAAGGCGACCTGTTCCGAATCGTGTGTGTGTACTACGATTCTGCGGGAGCCTGCGGGAGCGGTAAGTTCATTAACAATAACTTTTTTCATGCCAGCCTCCTGTGACACCTGCTCAACTAGTTGGAGCGTGGCCACCACAGTAAACGGAATACAAGTGCAGCCAGTTTACCAAACG

Full Affymetrix probeset data:

Annotations for 1626024_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720