FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626025_at:

>probe:Drosophila_2:1626025_at:165:675; Interrogation_Position=104; Antisense; TAGCCCAAGTGGTGCCCGTGGTGAA
>probe:Drosophila_2:1626025_at:522:533; Interrogation_Position=114; Antisense; GGTGCCCGTGGTGAAATCTGTTCCA
>probe:Drosophila_2:1626025_at:638:237; Interrogation_Position=128; Antisense; AATCTGTTCCAGTGGTGCAGCACGT
>probe:Drosophila_2:1626025_at:652:59; Interrogation_Position=13; Antisense; ATGTTCCGCATTATCGCTGTGATCT
>probe:Drosophila_2:1626025_at:237:257; Interrogation_Position=148; Antisense; CACGTTCCGGTGGTGAAGAATGTCC
>probe:Drosophila_2:1626025_at:398:369; Interrogation_Position=165; Antisense; GAATGTCCCAGTGGTTCAGCATGTC
>probe:Drosophila_2:1626025_at:174:115; Interrogation_Position=182; Antisense; AGCATGTCCCTGTGCTGAAGTCCTA
>probe:Drosophila_2:1626025_at:610:507; Interrogation_Position=193; Antisense; GTGCTGAAGTCCTACGCTGTTCCCA
>probe:Drosophila_2:1626025_at:635:15; Interrogation_Position=22; Antisense; ATTATCGCTGTGATCTTCGCCCTGG
>probe:Drosophila_2:1626025_at:292:513; Interrogation_Position=31; Antisense; GTGATCTTCGCCCTGGTAGCAATGG
>probe:Drosophila_2:1626025_at:263:539; Interrogation_Position=45; Antisense; GGTAGCAATGGCTTTTGCTGCTCCT
>probe:Drosophila_2:1626025_at:247:703; Interrogation_Position=57; Antisense; TTTTGCTGCTCCTGGTTACATTGAG
>probe:Drosophila_2:1626025_at:647:665; Interrogation_Position=73; Antisense; TACATTGAGCCCTCCTACGGTGTGG
>probe:Drosophila_2:1626025_at:425:671; Interrogation_Position=88; Antisense; TACGGTGTGGTTCCTGTAGCCCAAG

Paste this into a BLAST search page for me
TAGCCCAAGTGGTGCCCGTGGTGAAGGTGCCCGTGGTGAAATCTGTTCCAAATCTGTTCCAGTGGTGCAGCACGTATGTTCCGCATTATCGCTGTGATCTCACGTTCCGGTGGTGAAGAATGTCCGAATGTCCCAGTGGTTCAGCATGTCAGCATGTCCCTGTGCTGAAGTCCTAGTGCTGAAGTCCTACGCTGTTCCCAATTATCGCTGTGATCTTCGCCCTGGGTGATCTTCGCCCTGGTAGCAATGGGGTAGCAATGGCTTTTGCTGCTCCTTTTTGCTGCTCCTGGTTACATTGAGTACATTGAGCCCTCCTACGGTGTGGTACGGTGTGGTTCCTGTAGCCCAAG

Full Affymetrix probeset data:

Annotations for 1626025_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720