Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626026_at:

>probe:Drosophila_2:1626026_at:365:69; Interrogation_Position=1843; Antisense; AGGCCAGCGAGGTGTTCTTCTTCGA
>probe:Drosophila_2:1626026_at:454:533; Interrogation_Position=1910; Antisense; GGTGGTCATCCAAATGCTGGCCATG
>probe:Drosophila_2:1626026_at:237:475; Interrogation_Position=1937; Antisense; GTTACAGCTGGCCTTGCGGATGAAA
>probe:Drosophila_2:1626026_at:341:403; Interrogation_Position=2064; Antisense; GACTTCCTGGATATCTTGCACGAGA
>probe:Drosophila_2:1626026_at:349:401; Interrogation_Position=2087; Antisense; GACATGTTTTGGATACTCACCTCTC
>probe:Drosophila_2:1626026_at:321:149; Interrogation_Position=2112; Antisense; ACTTACGGCCTGGTTATGGTGCTGA
>probe:Drosophila_2:1626026_at:27:65; Interrogation_Position=2127; Antisense; ATGGTGCTGAAGCTAATCCTTCCCT
>probe:Drosophila_2:1626026_at:191:729; Interrogation_Position=2158; Antisense; TTGTGCTTTGCATCATGGCGGGAAA
>probe:Drosophila_2:1626026_at:429:431; Interrogation_Position=2189; Antisense; GAGTCTGGCCTCATACGAACAGCAA
>probe:Drosophila_2:1626026_at:598:615; Interrogation_Position=2236; Antisense; TGAATAGTGCCATGTCGCTGGTGCT
>probe:Drosophila_2:1626026_at:106:231; Interrogation_Position=2277; Antisense; AATGTTGGTCCTTGGCGGGATATCC
>probe:Drosophila_2:1626026_at:583:691; Interrogation_Position=2319; Antisense; TTTGCGGTAGTCCATGTGTTTCCAC
>probe:Drosophila_2:1626026_at:669:287; Interrogation_Position=2348; Antisense; CTGGCTGCTACTGTGGCGATTGACA
>probe:Drosophila_2:1626026_at:265:443; Interrogation_Position=2396; Antisense; GATGTCCCAGCTCCCGAATGAATTA

Paste this into a BLAST search page for me
AGGCCAGCGAGGTGTTCTTCTTCGAGGTGGTCATCCAAATGCTGGCCATGGTTACAGCTGGCCTTGCGGATGAAAGACTTCCTGGATATCTTGCACGAGAGACATGTTTTGGATACTCACCTCTCACTTACGGCCTGGTTATGGTGCTGAATGGTGCTGAAGCTAATCCTTCCCTTTGTGCTTTGCATCATGGCGGGAAAGAGTCTGGCCTCATACGAACAGCAATGAATAGTGCCATGTCGCTGGTGCTAATGTTGGTCCTTGGCGGGATATCCTTTGCGGTAGTCCATGTGTTTCCACCTGGCTGCTACTGTGGCGATTGACAGATGTCCCAGCTCCCGAATGAATTA

Full Affymetrix probeset data:

Annotations for 1626026_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime