FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626027_at:

>probe:Drosophila_2:1626027_at:136:203; Interrogation_Position=1506; Antisense; AACCTTCAATATTTAGTAGCCAGCA
>probe:Drosophila_2:1626027_at:5:675; Interrogation_Position=1522; Antisense; TAGCCAGCACATTACAGTTACCACT
>probe:Drosophila_2:1626027_at:630:127; Interrogation_Position=1541; Antisense; ACCACTACAACTGATCGTTCGAGAA
>probe:Drosophila_2:1626027_at:227:75; Interrogation_Position=1578; Antisense; AGGACATCGCAGGTCAGTTGGACAT
>probe:Drosophila_2:1626027_at:428:243; Interrogation_Position=1610; Antisense; AATATTCCGCATCCAGCTTTGATAG
>probe:Drosophila_2:1626027_at:418:341; Interrogation_Position=1625; Antisense; GCTTTGATAGTCATGTACCTGCTCA
>probe:Drosophila_2:1626027_at:408:339; Interrogation_Position=1645; Antisense; GCTCATCGGCGTAATCCTGGTGATA
>probe:Drosophila_2:1626027_at:132:523; Interrogation_Position=1673; Antisense; GTGGCCAATCTCAAACAACTGTGTA
>probe:Drosophila_2:1626027_at:476:465; Interrogation_Position=1782; Antisense; GATTGTCCCAAAATTGCAACGGCAT
>probe:Drosophila_2:1626027_at:117:67; Interrogation_Position=1805; Antisense; ATGGATCAGCATTTGTGCAGTGCCT
>probe:Drosophila_2:1626027_at:418:267; Interrogation_Position=1822; Antisense; CAGTGCCTTCGACGAGGATTTGGAT
>probe:Drosophila_2:1626027_at:420:175; Interrogation_Position=1868; Antisense; AACATACGCATGGTGACGGATTTAT
>probe:Drosophila_2:1626027_at:527:531; Interrogation_Position=1896; Antisense; GGGTGATTCCATTTACTACCTACAG
>probe:Drosophila_2:1626027_at:278:279; Interrogation_Position=1911; Antisense; CTACCTACAGCCTTACTCAAATTTG

Paste this into a BLAST search page for me
AACCTTCAATATTTAGTAGCCAGCATAGCCAGCACATTACAGTTACCACTACCACTACAACTGATCGTTCGAGAAAGGACATCGCAGGTCAGTTGGACATAATATTCCGCATCCAGCTTTGATAGGCTTTGATAGTCATGTACCTGCTCAGCTCATCGGCGTAATCCTGGTGATAGTGGCCAATCTCAAACAACTGTGTAGATTGTCCCAAAATTGCAACGGCATATGGATCAGCATTTGTGCAGTGCCTCAGTGCCTTCGACGAGGATTTGGATAACATACGCATGGTGACGGATTTATGGGTGATTCCATTTACTACCTACAGCTACCTACAGCCTTACTCAAATTTG

Full Affymetrix probeset data:

Annotations for 1626027_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720