FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626028_at:

>probe:Drosophila_2:1626028_at:106:85; Interrogation_Position=103; Antisense; AGTGTGGAGGTCAAAGTGCTGTCTT
>probe:Drosophila_2:1626028_at:690:219; Interrogation_Position=116; Antisense; AAGTGCTGTCTTACAATCCCACATA
>probe:Drosophila_2:1626028_at:201:235; Interrogation_Position=130; Antisense; AATCCCACATACGATTTCTGGTTTT
>probe:Drosophila_2:1626028_at:13:717; Interrogation_Position=145; Antisense; TTCTGGTTTTTCATGCCAACTGGCA
>probe:Drosophila_2:1626028_at:307:397; Interrogation_Position=16; Antisense; GACACCTACGACATGAACTGGGCTA
>probe:Drosophila_2:1626028_at:197:565; Interrogation_Position=166; Antisense; GGCAGACCCAAGGTGGTTACTCAGA
>probe:Drosophila_2:1626028_at:483:367; Interrogation_Position=198; Antisense; GAATGCATATTGGTCTGCTCGGACA
>probe:Drosophila_2:1626028_at:484:549; Interrogation_Position=226; Antisense; GGAGGTGTTTGCTTCACAGATCTGT
>probe:Drosophila_2:1626028_at:253:155; Interrogation_Position=241; Antisense; ACAGATCTGTGGTTCTACTGCGCAA
>probe:Drosophila_2:1626028_at:153:643; Interrogation_Position=254; Antisense; TCTACTGCGCAACTGGCATCGAAAT
>probe:Drosophila_2:1626028_at:639:373; Interrogation_Position=327; Antisense; GAAGATTTGTTACACCCATTCATTA
>probe:Drosophila_2:1626028_at:302:31; Interrogation_Position=366; Antisense; ATAATCTGCGTAACGTTTACACGAA
>probe:Drosophila_2:1626028_at:569:31; Interrogation_Position=46; Antisense; ATAATTGCAATTATCCTCCTGCTGC
>probe:Drosophila_2:1626028_at:691:311; Interrogation_Position=77; Antisense; GCCAGCAAAGCTTTATTAGATCCGA

Paste this into a BLAST search page for me
AGTGTGGAGGTCAAAGTGCTGTCTTAAGTGCTGTCTTACAATCCCACATAAATCCCACATACGATTTCTGGTTTTTTCTGGTTTTTCATGCCAACTGGCAGACACCTACGACATGAACTGGGCTAGGCAGACCCAAGGTGGTTACTCAGAGAATGCATATTGGTCTGCTCGGACAGGAGGTGTTTGCTTCACAGATCTGTACAGATCTGTGGTTCTACTGCGCAATCTACTGCGCAACTGGCATCGAAATGAAGATTTGTTACACCCATTCATTAATAATCTGCGTAACGTTTACACGAAATAATTGCAATTATCCTCCTGCTGCGCCAGCAAAGCTTTATTAGATCCGA

Full Affymetrix probeset data:

Annotations for 1626028_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720