FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626031_at:

>probe:Drosophila_2:1626031_at:335:45; Interrogation_Position=1592; Antisense; ATCCCAAGTACTTTGTGGCCGAAGA
>probe:Drosophila_2:1626031_at:620:519; Interrogation_Position=1621; Antisense; GTGGAATATCTGTTGGACGGCATCA
>probe:Drosophila_2:1626031_at:313:467; Interrogation_Position=1632; Antisense; GTTGGACGGCATCAAAGCCAGTTTA
>probe:Drosophila_2:1626031_at:643:77; Interrogation_Position=1657; Antisense; AGGATCATAGAAATGCCCGCCATGC
>probe:Drosophila_2:1626031_at:498:165; Interrogation_Position=1667; Antisense; AAATGCCCGCCATGCAAAGGATTGG
>probe:Drosophila_2:1626031_at:28:169; Interrogation_Position=1682; Antisense; AAAGGATTGGCGCTAGATTGCTAAA
>probe:Drosophila_2:1626031_at:500:463; Interrogation_Position=1697; Antisense; GATTGCTAAAGCGAACTGTCCCAGG
>probe:Drosophila_2:1626031_at:449:503; Interrogation_Position=1714; Antisense; GTCCCAGGATGCGAGGGTCACCAAT
>probe:Drosophila_2:1626031_at:565:649; Interrogation_Position=1731; Antisense; TCACCAATTTGCCTCGGATGATTAT
>probe:Drosophila_2:1626031_at:663:23; Interrogation_Position=1975; Antisense; ATACGAACCGACTGGGAGTTGATCT
>probe:Drosophila_2:1626031_at:552:391; Interrogation_Position=2014; Antisense; GAAACGCCATAGAATTCTAACTCTT
>probe:Drosophila_2:1626031_at:612:669; Interrogation_Position=2045; Antisense; TACTCCGTGTAGTTAGTAACCATTA
>probe:Drosophila_2:1626031_at:210:493; Interrogation_Position=2060; Antisense; GTAACCATTATCTTTGGGACTAATT
>probe:Drosophila_2:1626031_at:96:185; Interrogation_Position=2156; Antisense; AAAATACACACCAAACTGCGTGCCC

Paste this into a BLAST search page for me
ATCCCAAGTACTTTGTGGCCGAAGAGTGGAATATCTGTTGGACGGCATCAGTTGGACGGCATCAAAGCCAGTTTAAGGATCATAGAAATGCCCGCCATGCAAATGCCCGCCATGCAAAGGATTGGAAAGGATTGGCGCTAGATTGCTAAAGATTGCTAAAGCGAACTGTCCCAGGGTCCCAGGATGCGAGGGTCACCAATTCACCAATTTGCCTCGGATGATTATATACGAACCGACTGGGAGTTGATCTGAAACGCCATAGAATTCTAACTCTTTACTCCGTGTAGTTAGTAACCATTAGTAACCATTATCTTTGGGACTAATTAAAATACACACCAAACTGCGTGCCC

Full Affymetrix probeset data:

Annotations for 1626031_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720