Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626032_at:

>probe:Drosophila_2:1626032_at:270:309; Interrogation_Position=1346; Antisense; GCCAATCCTTGTGCAACCAGTGTTC
>probe:Drosophila_2:1626032_at:407:129; Interrogation_Position=1361; Antisense; ACCAGTGTTCCCAGTGCAGGACGCA
>probe:Drosophila_2:1626032_at:391:555; Interrogation_Position=1411; Antisense; GGACCCTTCAACAACCAACAGGTGT
>probe:Drosophila_2:1626032_at:128:155; Interrogation_Position=1428; Antisense; ACAGGTGTTCCAATCACAGCAGCAG
>probe:Drosophila_2:1626032_at:445:725; Interrogation_Position=1483; Antisense; TTGAAACCAAGCCAGCGACGCAGCA
>probe:Drosophila_2:1626032_at:280:263; Interrogation_Position=1506; Antisense; CAGCTTCTACCCATCCAAGGAAAAG
>probe:Drosophila_2:1626032_at:596:219; Interrogation_Position=1537; Antisense; AAGTCCAGCGAAAGATCCCACAATC
>probe:Drosophila_2:1626032_at:458:473; Interrogation_Position=1600; Antisense; GTTCAGGAGAAACCCCAGGATGTCA
>probe:Drosophila_2:1626032_at:452:203; Interrogation_Position=1652; Antisense; AAGCCGGCAGCAAGAAGTCGCCATT
>probe:Drosophila_2:1626032_at:89:15; Interrogation_Position=1674; Antisense; ATTACCCCGATCCATGGGTGGTGCA
>probe:Drosophila_2:1626032_at:712:345; Interrogation_Position=1696; Antisense; GCATCATTTGCGAGGACCAATCCAT
>probe:Drosophila_2:1626032_at:607:593; Interrogation_Position=1738; Antisense; TGTGTCGCTCGGTTTGGCAGGACTT
>probe:Drosophila_2:1626032_at:697:73; Interrogation_Position=1756; Antisense; AGGACTTGCTTGGTCCTGAGACCCA
>probe:Drosophila_2:1626032_at:170:665; Interrogation_Position=1828; Antisense; TACACTTCCGTGATAGCCTGGCCAA

Paste this into a BLAST search page for me
GCCAATCCTTGTGCAACCAGTGTTCACCAGTGTTCCCAGTGCAGGACGCAGGACCCTTCAACAACCAACAGGTGTACAGGTGTTCCAATCACAGCAGCAGTTGAAACCAAGCCAGCGACGCAGCACAGCTTCTACCCATCCAAGGAAAAGAAGTCCAGCGAAAGATCCCACAATCGTTCAGGAGAAACCCCAGGATGTCAAAGCCGGCAGCAAGAAGTCGCCATTATTACCCCGATCCATGGGTGGTGCAGCATCATTTGCGAGGACCAATCCATTGTGTCGCTCGGTTTGGCAGGACTTAGGACTTGCTTGGTCCTGAGACCCATACACTTCCGTGATAGCCTGGCCAA

Full Affymetrix probeset data:

Annotations for 1626032_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime